Skip to content

Что показывает биохимический анализ


Что показывает биохимический анализ крови. Расшифровка, нормы, таблица показателей при биохимии крови

Закрыть
  • Болезни
    • Инфекционные и паразитарные болезни
    • Новообразования
    • Болезни крови и кроветворных органов
    • Болезни эндокринной системы
    • Психические расстройства
    • Болезни нервной системы
    • Болезни глаза
    • Болезни уха
    • Болезни системы кровообращения
    • Болезни органов дыхания
    • Болезни органов пищеварения
    • Болезни кожи
    • Болезни костно-мышечной системы
    • Болезни мочеполовой системы
    • Беременность и роды
    • Болезни плода и новорожденного
    • Врожденные аномалии (пороки развития)
    • Травмы и отравления
  • Симптомы
    • Системы кровообращения и дыхания
    • Система пищеварения и брюшная полость
    • Кожа и подкожная клетчатка
    • Нервная и костно-мышечная системы
    • Мочевая система
    • Восприятие и поведение
    • Речь и голос
    • Общие симптомы и признаки
    • Отклонения от нормы
  • Диеты
    • Снижение веса
    • Лечебные
    • Быстрые
    • Для красоты и здоровья
    • Разгрузочные дни
    • От профессионалов
    • Монодиеты
    • Звездные
    • На кашах
    • Овощные
    • Детокс-диеты
    • Фруктовые
    • Модные
    • Для мужчин
    • Набор веса
    • Вегетарианство
    • Национальные
  • Лекарства
    • Пищеварительный тракт и обмен веществ
    • Кровь и система кроветворения
    • Сердечно-сосудистая система
    • Дерматологические препараты
    • Mочеполовая система и половые гормоны
    • Гормональные препараты
    • Противомикробные препараты
    • Противоопухолевые препараты и иммуномодуляторы
    • Костно-мышечная система
    • Нервная система
    • Противопаразитарные препараты, инсектициды и репелленты
    • Дыхательная система
    • Органы чувств
    • Прочие препараты
    ДЕЙСТВУЮЩИЕ ВЕЩЕСТВА
  • Врачи
  • Клиники
  • Справочник
    • Аллергология
    • Анализы и диагностика
    • Беременность
    • Витамины
    • Вредные привычки
    • Геронтология (Старение)
    • Дерматология
    • Дети
    • Женское здоровье
    • Инфекция
    • Контрацепция
    • Косметология
    • Народная медицина
    • Обзоры заболеваний
    • Обзоры лекарств
    • Ортопедия и травматология
    • Питание
    • Пластическая хирургия
    • Процедуры и операции
    • Психология
    • Роды и послеродовый период
    • Сексология
    • Стоматология
    • Травы и продукты
    • Трихология
    • Другие статьи
  • Словарь терминов
    • [А] Абазия .. Ацидоз
    • [Б] Базофилы .. Богатая тромбоцитами плазма
    • [В] Вазопрессин .. Выкидыш
    • [Г] Галлюциногены .. Грязи лечебные
    • [Д] Деацетилазы гистонов .. Дофамин
    • [Ж] Железы .. Жиры
    • [И] Иммунитет .. Искусственная кома
    • [К] Каверна .. Кумарин
    • [Л] Лапароскоп .. Лучевая терапия
    • [М] Макрофаги .. Мутация
    • [Н] Наркоз .. Нистагм
    • [О] Онкоген .. Отек
    • [П] Паллиативная помощь .. Пульс
    • [Р] Реабилитация .. Родинка (невус)
    • [С] Секретин .. Сыворотка крови
    • [Т] Таламус .. Тучные клетки
    • [У] Урсоловая кислота
    • [Ф] Фагоциты .. Фитотерапия
    • [Х] Химиотерапия .. Хоспис

что показывает, виды исследований, расшифровка результатов, норма


Биохимический анализ крови является простым и информативным методом первичной диагностики широкого спектра патологий.

Сколько стоит анализ крови?


Биохимический анализ мочи позволяет выявить не только наличие патологий мочеполовой системы, но и получить сведения о состоянии желчевыводящих путей.

Узнать стоимость...



Исследование мочи по Нечипоренко — количественное определение содержания в моче лейкоцитов, эритроцитов и цилиндров. В большинстве случаев назначается после обнаружения отклонений в общем анализе мочи.

Узнать больше...


Расширенный гематологический анализ крови позволит получить максимально точную картину состояния иммунной системы и диагностировать широкий спектр заболеваний.

Где можно сдать анализ?


Для того чтобы результаты анализов были максимально достоверными, необходимо правильно подготовиться к их сдаче.

Как подготовиться?




Практически ни одно медицинское обследование организма не обходится без лабораторных анализов. При всей своей простоте они способны дать врачу общую картину состояния пациента и указать на возможные патологии органов. Мы рассмотрим процесс подготовки к биохимическим исследованиям мочи и крови, укажем, какие показатели исследуют, и расскажем, что означают отклонения от нормальных значений.


Особенности проведения биохимического анализа

Поскольку кровь циркулирует во всех органах человеческого тела, ее химический состав может меняться — в зависимости от наличия патологий в одном или нескольких из них. Поэтому биохимический анализ крови — наиболее распространенное исследование, которое назначают при жалобах пациента на самочувствие и подозрениях на нарушение функции почек, печени, щитовидной железы.

Забор биоматериала осуществляется утром, с 8 до 11 часов, обязательно — на голодный желудок, но при этом время голодания не должно превышать 14 часов. Для анализа у пациента берут венозную кровь в объеме около пяти–восьми миллилитров.

Биохимический анализ мочи также является одним из базовых вспомогательных исследований: он позволяет выявить не только наличие патологий мочеполовой системы, но и получить сведения о состоянии желчевыводящих путей и работе многих систем организма. Анализ назначают в период беременности, при сахарном диабете и подозрениях на заболевания почек.

Забор биоматериала проводят в домашних условиях, в течение суток, начиная с раннего утра, собирая мочу в емкость. Важные правила при сборе:

  • использовать только стерильную емкость;
  • первую утреннюю порцию собирать не нужно;
  • перед мочеиспусканием провести гигиенические процедуры;
  • между походами в туалет и до передачи в клинику мочу необходимо хранить в холодильнике (не более суток).

После сбора всего биоматериала за сутки, его перемешивают, измеряют объем, переливают немного (до 50 мл) в специальную маленькую баночку, на которой указывают общее количество мочи за сутки, рост и вес пациента. Затем емкость можно передать в лабораторию.

Расшифровка биохимического анализа крови

Результатом анализа является выданное заключение о содержании химических веществ и биологических агентов в крови. Как правило, документ представляет собой таблицу, в первой колонке которой указано название показателя, во второй — выявленное значение, в третьей — диапазон нормы. По этой таблице специалист оценивает отклонения от нормы и на основании этого может судить о нарушениях в работе органов.

Показатели биохимического анализа и их нормативные величины

Диапазон нормальных значений для того или иного показателя может меняться в зависимости от клиники и лаборатории, и это не является ошибкой. Окончательное решение, считать ли значение превышенным, нормальным или пониженным, принимает врач на основе анамнеза.

В нижеприведенной таблице можно ознакомиться с примерными показателями нормы содержания веществ при биохимическом анализе крови:

Показатели

Норма

Единицы
измерения показателей

У мужчин

У женщин

Белки

Альбумин

33–50

г/л

Общий белок

64–83

С-реактивный белок (СРБ)

до 5

мг/л

Миоглобин

19–92

12–76

мкг/л

Трансферрин

2,15–3,65

2,50–3,80

г/л

Ферритин

20–350

10-120

мкг/л

ЛЖСС

20–62

мкмоль/л

ОЖСС

50–85

Ферменты

АлАт

до 45

до 34

 

 

 

Ед/л

АсАт

до 41

до 31

ГГТ

до 49

до 32

ЛДГ

до 250

Альфа-амилаза

27-100

Амилаза панкреатическая

до 50

Креатинкиназа

до 190

до 167

Креатинкиназа МВ

до 24

Щелочная фосфатаза

150

120

Липаза

до 190

Холинэстераза

5800–14000

Липиды

Общий холестерол и липопротеиды

3,0–6,0

ммоль/л

очень низкой плотности

0,26–1,04

низкой плотности

2,2–4,8

1,92–4,51

высокой плотности

0,7–1,73

0,8–2,28

Триглицериды

0,34–3,00

Углеводы

Глюкоза

3,88–5,83

ммоль/л

Фруктозамин

до 319

мкмоль/л

Пигменты

Билирубин общий

3,4–17,1

мкмоль/л

прямой

до 3,4

непрямой

до 19

Показатели азотистого обмена

Креатинин

62–115

53–97

Мочевая кислота

210–420

145–350

Мочевина

2,4–6,4

ммоль/л

Витамины и микроэлементы

Сывороточное железо

11,6–30,4

8.9–30,4

Калий

3,5–5,5

ммоль/л

Кальций

2,15–2,5

Натрий

135–145

Хлор

98–107

Магний

0,66–1,05

Фосфор

0,87–1,45

Фолиевая кислота

3–17

нг/мл

О чем говорят отклонения?

Следует помнить, что отклонения от нормы не обеспечивают моментальную постановку диагноза, а лишь сигнализируют о проблемах в организме. Каждый показатель следует рассматривать как индивидуально, так и в совокупности с другими. Ниже мы рассмотрим, о чем говорит повышенное или пониженное содержание тех или иных веществ.

Белки и аминокислоты

Пониженный показатель общего белка в крови может сказать о наличии таких патологий, как нарушение обменных процессов, хронические кровотечения, анемия и т. д. Впрочем, пониженный белок нормален на поздних сроках беременности, в период кормления грудью, при сильных физических нагрузках и наоборот — для лежачих больных. Также часто снижение уровня белка происходит из-за диет и голодания.

Превышение нормального количества белка в сыворотке крови говорит о наличии серьезных патологий почек, инфекций, злокачественных опухолей, аутоиммунных заболеваниях и т. п.

На серьезные проблемы может указывать и снижение содержания аминокислот — чаще всего оно свидетельствует о проблемах печени и почек, нарушении обменных процессов.

Показатели азотистого обмена

Пониженный уровень мочевины, креатинина и мочевой кислоты в крови говорит о голодании, печеночной недостаточности, замедлении обмена веществ или полиурии.

Повышение мочевины, выявленное при биохимическом анализе крови, сигнализирует о проблемах с почками, отравлении или артериальной гипертензии. Для креатинина увеличенные показатели тоже могут быть признаком патологии почек, а кроме этого — кишечной непроходимости, мышечной дистрофии, сахарного диабета. Повышение уровня мочевой кислоты говорит о наличии таких заболеваний, как подагра, диабет, лейкоз, а также о патологиях кожи, инфекциях или отравлениях.

Метаболиты углеводного обмена и глюкоза

Превышение нормального показателя глюкозы является одним из основных симптомов сахарного диабета, но также может быть сигналом травм головного мозга, заболеваний ЦНС, надпочечников, щитовидной железы и гипофиза. Понижение уровня глюкозы в крови свидетельствует о возможных патологиях поджелудочной железы, печени, эндокринной системы.

Пептиды

Показатель С-пептида является важным для диагностики сахарного диабета и ряда других заболеваний. Превышение нормального показателя свидетельствует о наличии опухоли, панкреатита, избыточном синтезе инсулина. Снижения уровня характерно для сахарного диабета первого типа, воспалительных реакций.

Показатели липидного обмена

Наибольшее диагностическое значение в этой группе имеет холестерин. Его повышение свидетельствует о возможных онкозаболеваниях, ишемической болезни сердца, инфаркте миокарда, панкреатите, сахарном диабете и других серьезных патологиях. Не менее опасно и понижение уровня холестерина: оно может быть связано с опухолями или циррозом печени, заболеваниями легких, ревматоидным артритом.

Ферменты

При нарушении нормального уровня ферментов можно судить о заболеваниях тех органов, которыми данный вид ферментов вырабатывается. Например, показатель АсАт будет повышен при патологиях печени и сердца, а превышение нормального значения АлАт сигнализирует о массовом отмирании клеток печени.

Витамины и микроэлементы

При исследовании крови обычно выявляют показатели содержания витаминов D, B12, а также фолиевой кислоты.

Среди микроэлементов в крови наибольшее значение имеют показатели калия и натрия. Снижение уровня калия чревато тошнотой, рвотой, непроизвольным мочеиспусканием или дефекацией. Превышение нормы этого элемента сопутствует помрачнению сознания, падению артериального давления, аритмии.

Недостаток натрия, в свою очередь, может стать причиной сонливости, головной боли, тошноты и рвоты, судорог и даже комы. При избытке микроэлемента больной испытывает жажду, раздражительность, мышечные подергивания и судороги.

Кстати
Некоторые путают общий (клинический) и биохимический анализы крови. Первый дает сведения о содержании в плазме крови эритроцитов, лейкоцитов, тромбоцитов, а также о показателе СОЭ, количестве белка и гемоглобина в крови. Данное исследование более простое и недорогое, однако менее информативное. Часто биохимический и общий анализы крови назначают одновременно: их показатели дополняют друг друга.


Расшифровка биохимического анализа мочи: норма и патологии

Анализ мочи предполагает оценку около 15-ти показателей, ниже мы приведем нормативные величины самых важных и рассмотрим возможные причины отклонений:

Мочевина

Норма — 333–587 ммоль в сутки. Снижение уровня говорит о патологиях печени и почек, но также может объясняться вегетарианской диетой, периодом восстановления после травм и активного роста у детей. Превышение нормы происходит во время беременности, при употреблении большого количества белка, а также при гепатитах, диабете, различных воспалениях мочевыводящих путей и других патологиях.

Креатинин

В норме показатель составляет 7,4–17,6 ммоль/сутки у мужчин и 5,5–15,9 ммоль/сутки
у женщин. Повышенное значение может говорить о патологии гипофиза и щитовидной железы, о заболевании диабетом, но также встречается при чрезмерных физических нагрузках и высокобелковом питании. Снижение креатинина часто происходит при лейкозе, тяжелых заболеваниях почек, анемии.

Мочевая кислота

Нормальное значение — от 0,4 до 1 грамма за сутки. Превышение нормы свойственно пациентам с заболеванием подагрой; пониженное значение фиксируется при нарушениях обмена веществ или почечной недостаточности.

Микроэлементы

Норма содержания калия — 38–82 ммоль в сутки, натрия — от 100 до 260 ммоль в сутки, хлора — 100–250 ммоль в сутки, кальция — 2,5–6,2 ммоль в сутки. По отклонению содержания калия можно определить патологию почек. Ненормальное количество натрия сигнализирует о диабете, заболеваниях надпочечников, почек и т. д. Повышение уровня хлора является симптомом обезвоживания, а понижение — болезней надпочечников и почек. Превышение нормы кальция в моче может свидетельствовать об остеопорозе, синдроме Иценко-Кушинга. Снижение — о возможных острых почечных патологиях, рахите, онкозаболеваниях костей.

Белки

Допускаются в моче в количестве менее 0,033 грамм на литр. Превышение этого значения может быть вызвано диабетом, аутоиммунными заболеваниями, аллергическими реакциями или инфекциями.

Оксалаты

Не должны превышать значения 40 мг в сутки. Повышенный показатель при отсутствии своевременного лечения приводит к образованию камней в почках. В некоторых случаях чрезмерное количество оксалатов в моче вызвано употреблением большого количества продуктов, содержащих щавелевую кислоту: помидоров, цитрусовых, спаржи, щавеля. Еще одной причиной может являться сахарный диабет.

Биохимические анализы крови и мочи помогают обнаружить патологии практически всех органов человека, проконтролировать течение выявленных заболеваний и сигнализировать о возникновении новых. Поэтому очень важна правильная подготовка к сдаче анализов, корректно выполненный забор материала и, конечно, современное и точное оборудование в клинике, где проводят лабораторные исследования.

что показывает, норма, подготовка к сдаче

Биохимический анализ крови представляет собой лабораторный тест, который позволяет оценить функционирование всех внутренних органов. К тому же он предоставляет информацию о метаболизме и обмене веществ, а также выявляет протекание опасных недугов задолго до того, как возникают первые клинические проявления болезни.

Расшифровка результатов находится в компетенции врача-гематолога, который во время этого процесса пользуется специальным бланком, включающим в себя все допустимые показатели биохимического анализа крови.

Далеко не всегда норма и полученные сведения совпадают: концентрация того или иного вещества в главной биологической жидкости может как понижаться, так и повышаться. В подавляющем большинстве случаев на это влияют различные заболевания и патологические процессы.

Реже провокаторами могут выступать менее безобидные факторы:

  • неправильное применение лекарственных препаратов;
  • нерациональное питание;
  • физическое истощение организма.

Чтобы с точностью установить причину, информации, полученной в результате биохимии, будет недостаточно. Для выявления источника необходимо комплексное обследование пациентов. Помимо этого, клиницист учитывает симптомы, на которые жалуется больной.

Биохимическое исследование крови подразумевает забор биологического материала из вены. Такой процесс имеет собственную последовательность действий. Необходимо отметить, что для получения наиболее достоверных результатов требуется специфическая подготовка к сдаче анализа. Если этого не сделать, может потребоваться повторное прохождение процедуры, что в некоторых случаях нежелательно, а именно:

  • для детей;
  • лицам преклонного возраста;
  • ослабленным пациентам;
  • представительницам женского пола во время вынашивания малыша.

Нормы биохимического анализа крови индивидуальны для каждого человека. Это обусловлено тем, что показатели могут несколько отличаться в зависимости от таких факторов, как половая принадлежность и возрастная категория человека.

Существует официальный бланк БАК (данные, которые входят в биохимический анализ), применяемый во всех лаборатория.

Следующая таблица наиболее точно отображает основные показатели:

Составной элемент крови

Нормальные показатели

Общий белок

дети – 58-76 г/л;

взрослые – 64-83 г/л.

Альбумины

дети – 38-54 г/л;

взрослые – 35-50 г/л.

Миоглобин

женщины – 12-76 мкг/л;

мужчины – 19-92 мкг/л.

Трансферрин

2-4 г/л

Ферритин

мужчины – 20-250 мкг/л;

женщины – 10-120 мкг/л.

ОЖСС

26.85-41.2 мкмоль/л

СРБ

не больше 0.5 мг/л

Ревматоидный фактор

до 10 ед/мл

Общий холестерин

5.2 ммоль/л

Церулоплазмин

150-600 мг/л

Триглицериды

0.55-1.65 ммоль/л

Мочевина

дети – 18-64 ммоль/л;

взрослые – 2.5-83 ммоль/л.

Креатинин

мужчины – 62-115 мкмоль/л;

женщины – 53-97 мкмоль/л;

дети – 27-62 мкмоль/л.

Мочевая кислота

мужчины – 0.24-0.5 ммоль/л;

женщины – 0.16-044 ммоль/л;

дети – 0.12-0.32 ммоль/л.

Билирубин

общий – 3.4-17.1;

связанный – 25% от общего;

свободный – 75% от общего.

Глюкоза

дети – 3.33-5.55 моль/л;

взрослые – 3.89-5.83 моль/л.

Фруктозамин

не более 280 ммоль/л

АсАТ

женщины – до 31 ед/л;

мужчины – до 35 ед/л;

дети – индивидуально.

АлАТ

женщины – до 31 ед/л;

мужчины – до 41 ед/л.

ЩФ

дети – 1300-600 ед/л;

взрослые – 20-130 ед/л.

Альфа-амилаза

не больше 120 ед/л

Липаза

0-417 ед/л

КК и КФК

женщины – до 170 ед/л;

мужчины – до 195 ед/л.

МВ-фракция КК

не меньше 10 ед/л

ЛДГ

120-240 ед/л

ГГТП

дети – от 17 до 163 ед/л;

женщины – 7-31 ед/л;

мужчины – 11-50 ед/л.

Натрий

дети – 130-145 ммоль/л;

взрослые – 134-150 ммоль/л.

Калий

дети – 3.6-6 ммоль/л;

взрослые – 3.6-5.4 ммоль/л.

Хлориды

95-110 ммоль/л

Фосфор

дети – 1.3-2.1 ммоль/л;

взрослые - 0.65-1.3 ммоль/л

Магний

0.65-1.1 ммоль/л

Железо

мужчины – 11.6-30.4 мкмоль/л;

женщины – 8.9-30.4 мкмоль/л;

дети – 7.1-21.4 мкмоль/л.

Кальций

2-2.8 ммоль/л

Цинк

дети – 11-24 мкмоль/л;

взрослые – 11-18 мкмоль/л.

ЛПНП

1.71-3.5 ммоль/л

Гамма-ГТ

женщины - до 38 ед/л;

мужчины – до 55 ед/л.

Хлор

98-107 ммоль/л

Фолиевая кислота

3-17 нг/мл

Витамин В12

180-900 нг/мл

Молочная кислота

дети – 295 ед/л;

взрослые – 250 ед/л.

Очень важно отметить, что норма биохимического анализа крови у женщин в период вынашивания ребенка будет отличаться от вышеуказанных параметров. Это может быть как совершенно нормальным явлением, так и признаком протекания различных недугов. Норма это или нарушение, может определить только клиницист.

Вышеуказанные компоненты главной биологической жидкости указывают на то, что в биохимический анализ крови входят:

  • белки и ферменты;
  • липиды и пигменты;
  • углеводы и витамины;
  • показатели азотистого обмена;
  • широкий спектр микроэлементов.

Поскольку биохимический анализ крови показывает общее состояние организма и функционирование внутренних органов, то его могут назначать в профилактических целях. Однако зачастую показанием выступает предъявление пациентом жалоб на те или иные симптомы.

Подобное исследование позволяет диагностировать:

  • почечную и печеночную недостаточность;
  • дисфункцию сердечной мышцы, в частности, инфаркт и инсульт;
  • эндокринные и гинекологические недуги;
  • болезни системы кроветворения;
  • нарушения в работе таких органов, как желудок, поджелудочная железа и кишечник.

Для новорожденных необходимость в таком тесте заключается в определении наличия генетических недугов. В младшем возрасте показаниями могут служить отставание в физическом и умственном развитии.

Такая процедура, как и любое другое диагностическое исследование обладает рядом положительных и отрицательных качеств. При этом первых черт намного больше, чем вторых.

Достоинства подобного изучения крови человека:

  • высокая информативность – это позволяет не только диагностировать недуг на ранних стадиях его прогрессирования, но также дает возможность врачам контролировать эффективность выбранной тактики терапии;
  • безболезненность – такое исследование хорошо переносится не только взрослыми, но и детьми;
  • общедоступностью – такой анализ проводится как в частных, так и в государственных медицинских учреждениях;
  • быстрота диагностирования – непосредственно забор биологического материала не отнимает больше 5 минут времени, а расшифровка результатов занимает в среднем 1-2 суток;
  • отсутствие сложных подготовительных мероприятий – если человеку необходимо сдать биохимический анализ крови, то подготовка к сдаче крови будет обязательной, но она состоит из короткого перечня несложных рекомендаций.

Что касается недостатков, то их не так много, точнее, он один – незначительные отклонения от нормы, которые представляет вышеуказанная таблица, в зависимости от оснащения лаборатории. Это говорит о том, что когда человеку врач назначал несколько раз сдавать биохимический анализ крови, то делать это необходимо в том же самом учреждении, в котором проводилось первое исследование.

Чтобы во время интерпретации результатов клиницист получил наиболее достоверную информацию, необходима предварительная подготовка к биохимическому анализу крови, которая включает в себя, такие правила:

  • Последний прием пищи должен быть осуществлен за 12 часов до забора биологической жидкости – это означает, что такое исследование проводится только натощак.
  • За день до теста необходимо отказаться от распития кофе, крепкого зеленого или черного чая.
  • Соблюдение щадящей диеты на протяжении 3 суток до посещения медицинского учреждения. Рекомендуется отказаться от жирных, жареных и острых блюд. Взрослым также показано исключить вредные привычки.
  • За сутки до анализа необходимо снизить физическую активность.
  • Отказ от приема медикаментов за несколько недель до предполагаемой даты посещения клиники. Если по какой-либо причине сделать это не представляется возможным, то надо в обязательном порядке проинформировать об этом гематолога.
  • В день прохождения диагностического теста следует исключить влияние стрессовых ситуаций, эмоционального возбуждения и нервного напряжения, поскольку это может исказить результаты.

Примерно за 10 минут до того, как будет проведен биохимический анализ крови, человеку необходимо успокоиться для нормализации дыхания и частоты сердечного ритма.

Надо отметить, что маленьким детям подготовка к анализу крови не нужна. Помимо этого, в ней нет необходимости у пациентов, находящихся в тяжелом состоянии. При этом на биохимическое исследование лучше всего идти в первой половине дня – в утренние часы. Биохимический анализ крови и подготовка к нему – два неразрывных понятия.

Для биохимического анализа крови у взрослых и детей необходим биологический материал, взятый из вены. Существует специальный алгоритм забора такой жидкости, известный каждому квалифицированному работнику медицинского учреждения.

Забор крови для БАК

Прежде всего, регистрируются данные человека либо в электронном, либо в письменном виде. Для пациента готовят специальное кресло, чтобы он находился в удобном, полулежачем положении.

Локтевой сустав человека обязательно должен лежать в разогнутом виде на специальном валике, то есть внутренней стороной вверх. Во время подготовки шприца и иглы клиницист просит больного совершить сжимательные движения кулаком – это нужно для поиска вены.

Непосредственно взятие крови включает в себя такие манипуляции:

  • Перетягивание области выше локтя при помощи резинового жгута или тугой повязки. Чтобы избежать травмирования кожи, под утягивающий элемент подкладывают кусочек ткани.
  • Дезинфекция кожного покрова вокруг локтевой вены медицинским спиртом.
  • Введение иглы в вену и медленное оттягивание поршня. Примечательно то, что после начала поступления крови жгут обязательно снимают. Биохимический анализ крови предполагает забор от 2 до 5 миллилитров материала.
  • Извлечение шприца после получения достаточных объемов биологической жидкости. К месту прокола прикладывают кусочек ваты с нанесенным на него дезинфицирующим раствором. Ватный тампон необходимо держать примерно 5 минут.
  • Маркировка пробирки с кровью и ее перемещение в стерильный контейнер.

В некоторых клиниках подобный процесс осуществляется при помощи специальной вакуумной пробирки, которая позволяет свести к минимуму то, что биохимический анализ крови норма будет искажена.

Такая процедура выполняется при помощи одноразового шприца, а тактика забора крови ничем не отличается от обычной, до момента прокола кожи иглой. Перед тем как ввести иглу в вену, в специальный держатель устанавливают пробирку, которая вакуумным путем наполняется биологическим образцом. Манипуляции после взятия крови полностью идентичны вышеуказанным.

Чтобы избежать диагностирования того или иного опасного недуга у взрослых или детей при помощи такого теста, как биохимический анализ крови, необходимо соблюдать несложные профилактические мероприятия, направленные на предупреждение возникновения какой-либо патологии. Для этого людям нужно лишь вести здоровый образ жизни, правильно питаться, и не реже 2 раз в год проходить всестороннее обследование в медицинском учреждении с посещением всех клиницистов.

Биохимический анализ крови - статьи об анализах и диагностике

Какие существуют показания к назначению биохимического анализа крови?

Биохимический анализ крови важен для диагностики практически всех болезней, поэтому его назначают в первую очередь.

Какие показатели включены в стандартный биохимический анализ крови?

Глюкоза (в крови)

Основной тест в диагностике сахарного диабета. Этот анализ очень важен при подборе терапии и оценки эффективности лечения диабета. Понижение уровня глюкозы наблюдается при некоторых эндокринных заболеваниях и нарушениях функции печени.

Нормальные показатели глюкозы в крови:

Возраст Уровень глюкозы, ммоль/л
< 14 лет 3,33 - 5,55
14 - 60 лет 3,89 - 5,83
60 - 70 лет 4,44 - 6,38
> 70 лет 4,61 - 6,10

Билирубин общий

Желтый пигмент крови, которыйобразуется в результате распада гемоглобина, миоглобина и цитохромов. Основные причины повышения количества общего билирубина в крови: поражение клеток печени (гепатиты, цирроз), усиленный распад эритроцитов (гемолитические анемии), нарушение оттока желчи (например, желчнокаменная болезнь).

Нормальные значения общего билирубина: 3,4 - 17,1 мкмоль/л.

Билирубин прямой (билирубин конъюгированный, связанный)

Фракция общего билирубина крови. Прямой билирубин повышается при желтухе, развившейся из-за нарушения оттока желчи из печени.

Нормальные значения прямого билирубина: 0 - 7,9 мкмоль/л.

Билирубин непрямой (билирубин неконъюгированный, свободный)

Разница между показателями общего и прямого билирубина. Этот показатель повышается при усилении распада эритроцитов – при гемолитической анемии, малярии, массивных кровоизлияниях в ткани и т.п.

Нормальные значения непрямого билирубина: < 19 мкмоль/л.

АсАТ (АСТ, аспартатаминотрансфераза)

Один из основных ферментов, синтезирующихся в печени. В норме содержание этого фермента в сыворотке крови невелико, так как большая его часть находится в гепатоцитах (печеночных клетках). Повышение наблюдается при заболеваниях печени и сердца, а также при длительном приеме аспирина и гормональных контрацептивов.

Нормальные значения АсАТ:

  • Женщины – до 31 Ед/л;
  • Мужчины – до 37 Ед/л.

АлАТ (АЛТ, аланинаминотрансфераза)

Фермент, синтезирующийся в печени. Большая часть его находится и работает в клетках печени, поэтому в норме концентрация АЛТ в крови невелика. Повышение наблюдается при массовой гибели печеночных клеток (например, при гепатите, циррозе), тяжелой сердечной недостаточности и заболеваниях крови.

Нормальные значения АлАТ:

  • Женщины – до 34 Ед/л;
  • Мужчины – до 45 Ед/л.

Гамма-ГТ (гамма-глутамилтрансфераза)

Фермент, содержащийся преимущественно в клетках печени и поджелудочной железы. Повышение его количества в крови наблюдается при заболеваниях этих органов, а также при длительном приеме алкоголя.

Нормальные значения гамма-ГТ:

  • Женщины - до 38 Ед/л;
  • Мужчины - до 55 Ед/л.

Фосфатаза щелочная

Фермент, широко распространенный в тканях человека. Наибольшее клиническое значение имеют печеночная и костная формы щелочной фосфатазы, активность которых и определяется в сыворотке крови.

Нормальные значения фосфатазы щелочной: 30-120 Ед/л.

Холестерин (холестерол общий)

Основной липид крови, который поступает в организм с пищей, а также, синтезируется клетками печени.

Нормальные показатели холестерина: 3,2-5,6 ммоль/л.

Липопротеины низкой плотности (ЛПНП)

Одна из самых атерогенных, «вредных» фракций липидов. ЛПНП очень богаты холестерином и, транспортируя его к клеткам сосудов, задерживаются в них, образуя атеросклеротические бляшки.

Нормальные показатели ЛПНП: 1,71-3,5 ммоль/л.

Триглицериды

Нейтральные жиры, находящиеся в плазме крови, важный показатель липидного обмена.

Нормальные показатели триглицеридов: 0,41-1,8 ммоль/л.

Общий белок

Показатель, отражающий общее количество белков в крови. Его снижение наблюдается при некоторых болезнях печени и почек, сопровождающихся повышенным выведением белка с мочой. Повышение – при заболеваниях крови и инфекционно-воспалительных процессах.

Нормальные значения общего белка: 66-83 г/л.

Альбумин

Важнейший белок крови, составляющий примерно половину всех сывороточных белков. Уменьшение содержания альбумина может быть также проявлением некоторых болезней почек, печени, кишечника. Повышение альбумина обычно связано с обезвоживанием.

Нормальные значения альбумина: 35-52 г/л

Калий (К+)

Электролит, содержащийся преимущественно внутри клеток. Повышение уровня калия в крови чаще всего наблюдается при острой и хронической почечной недостаточности, резком уменьшении количества выделяемой мочи или полном ее отсутствии, чаще всего связанным с тяжелыми заболеваниями почек.

Нормальные значения калия: 3,5-5,5 ммоль/л.

Натрий (Na+)

Электролит, содержащийся преимущественно во внеклеточной жидкости, и в меньшем количестве - внутри клеток. Он отвечает за работу нервной и мышечной ткани, пищеварительных ферментов, кровяное давление, водный обмен.

Нормальные значения натрия:136-145 ммоль/л.

Хлор (Сl-)

Один из главных электролитов, который находится в крови в ионизированном состоянии и играет важную роль в поддержании водно-электролитного и кислотно-основного балансов в организме.

Нормальные значения хлора: 98-107 ммоль/л.

Креатинин

Вещество, которое играет важную роль в энергетическом обмене мышечной и других тканей. Креатинин полностью выводится почками, поэтому определение его концентрации в крови имеет наибольшее клиническое значение для диагностики заболеваний почек.

Нормальные значения креатинина:

  • Женщины - 53 - 97 мкмоль/л;
  • Мужчины - 62 – 115 мкмоль/л.

Мочевина

Вещество, являющееся конечным продуктом метаболизма белков в организме. Мочевина выводится почками, поэтому определение ее концентрации в крови дает представление о функциональных способностях почек и наиболее широко используется для диагностики почечной патологии.

Нормальные значения мочевины: 2,8-7,2 ммоль/л.

Мочевая кислота

Один из конечных продуктов метаболизма белков в организме. Мочевая кислота полностью выводится почками. Повышение концентрации мочевой кислоты встречается при почечнокаменной болезни, других заболеваниях почек, протекающих с почечной недостаточностью.

Нормальные значения мочевой кислоты:

  • Мужчины - 210 - 420 мкмоль/л;
  • Женщины - 150 - 350 мкмоль/л.

С-реактивный белок (СРБ)

Чувствительный элемент крови, быстрее других реагирующий на повреждения тканей. Наличие реактивного белка в сыворотке крови – признак воспалительного процесса, травмы, проникновения в организм чужеродных микроорганизмов – бактерий, паразитов, грибов. Чем острее воспалительный процесс, активнее заболевание, тем выше С-реактивный белок в сыворотке крови.

Нормальные значения С-реактивного белка: 0 - 5 мг/л.

Железо (сывороточное железо)

Жизненно важный микроэлемент, который входит в состав гемоглобина, участвует в транспорте и депонировании кислорода и играет важную роль в процессах кроветворения.

Нормальные значения сывороточного железа:

  • Женщины - 8,95 - 30,43 мкмоль/л;
  • Мужчины - 11,64 - 30,43 мкмоль/л.

Как подготовиться к исследованию?

За сутки до взятия крови на биохимию необходимо исключить прием алкоголя, за 1 час – курение. Взятие крови желательно производить натощак в утренние часы. Между последним приемом пищи и взятием крови должно пройти не менее 12 часов. Сок, чай, кофе, жевательная резинка не допускаются. Можно пить воду. Необходимо исключить повышенные психоэмоциональные и физические нагрузки.

Какие сроки исполнения анализа?

1 день.

Как оценивают результаты биохимического анализа крови?

Использование различных методов диагностики разными клиниками приводит к неодинаковым результатам, могут также отличаться единицы измерения. Поэтому для правильной расшифровки результата биохимического анализа крови требуется консультация лечащего врача.

Биохимический анализ крови: что это такое, показатели

Содержание статьи:

Биохимический анализ крови (биохимия крови) – это комплекс лабораторных исследований, который позволяет оценить состояние внутренних органов и систем организма.

Результаты биохимического исследования имеют немаловажное значение для диагностики многих патологических процессов (в том числе на ранних стадиях) и подбора адекватного лечения.

Биохимический анализ крови - одно из базовых исследований, которое назначается при большинстве заболеваний внутренних органов, а также в профилактических целях

Помимо исследования крови в ряде случаев проводится биохимический анализ других биологических жидкостей пациента.

Исследование глюкозы крови рекомендуется регулярно проводить всем людям старше 45 лет, так как изменение данного показателя при развитии сахарного диабета происходит раньше, чем возникают первые клинические признаки заболевания.

С профилактической целью данный анализ рекомендуется проводить не реже одного раза в год. При наличии хронических заболеваний печени, почек, необходимости в длительном применении лекарственных средств, наличии профессиональных вредностей биохимический анализ крови у взрослых проводят 2–4 раза в год.

Подготовка к сдаче биохимического анализа крови

Перед сдачей анализа целесообразно проконсультироваться с врачом, который подробно объяснит, что такое биохимический анализ крови, с какой целью он проводится и что показывает, а после расшифрует полученные результаты исследования по каждому параметру.

Для биохимического исследования необходима венозная кровь (используется сыворотка крови). Забор крови производят утром до 11:00, натощак, с последнего приема пищи должно пройти не менее восьми часов. Не рекомендуется сдавать кровь после проведения физиотерапевтических процедур и рентгенологического исследования. Накануне забора крови необходимо исключить употребление жирной и жареной пищи, кофе, крепкого чая и спиртных напитков. Следует избегать физических и психических нагрузок. При необходимости повторных исследований рекомендуется сдавать анализы в той же лаборатории с максимально похожими условиями подготовки.

Нормы показателей биохимического анализа крови

Биохимический анализ крови обычно проводится при комплексном обследовании пациента, любое изменение показателей указывает на те или иные процессы, происходящие в организме. Может назначаться стандартная панель биохимических тестов (полный биохимический анализ) или исследование конкретных показателей, в зависимости от цели исследования и имеющейся клинической картины. Нормативы исследуемого показателя для мужчин и женщин могут быть общими или отличаться.

Снижение содержания кальция наблюдается при рахите, хронической почечной и печеночной недостаточности, панкреатите.

Нормальные значения показателей биохимического исследования представлены в таблице. В разных лабораториях нормы и единицы измерения могут варьировать.

Нормы показателей биохимического анализа крови:

Расшифровка показателей биохимического анализа крови

Общий белок

Общий белок является важным показателем белкового обмена в организме и представляет собой суммарное содержание альбумина и глобулинов в сыворотке крови. Белки крови человека принимают участие в поддержании осмотического давления и pH крови, в процессе свертывания крови, переносят стероидные гормоны, липиды, билирубин.

Увеличение концентрации общего белка происходит при обезвоживании организма (при обширных ожогах, упорной рвоте, диарее и т. д.). Повышение данного показателя в некоторых случаях говорит о наличии в организме инфекционного процесса, аутоиммунных заболеваний, злокачественных новообразований с гиперпродукцией патологических белков.

Снижение общего белка может быть признаком недостаточного поступления белка с пищей, чрезмерных физических нагрузках, травм, длительной лихорадки, хронических кровотечений, анемии, тиреотоксикоза, заболеваний печени, почек, кишечника, а также злокачественных опухолей.

Для биохимического исследования необходима венозная кровь (используется сыворотка крови). Забор крови производят утром до 11:00, натощак, с последнего приема пищи должно пройти не менее восьми часов.

Физиологическое снижение уровня общего белка отмечается у детей первого года жизни, беременных и у кормящих грудью женщин, а также у пациентов, находящихся на длительном постельном режиме.

Глюкоза

Глюкоза – это органическое соединение, основной участник углеводного обмена. Более 50% энергии организм человека получает в реакциях окисления глюкозы, которая поступает с пищей и продуцируется клетками организма из лактата, аминокислот и пр. Избыток глюкозы откладывается в печени в виде гликогена.

Измерение концентрации глюкозы в крови играет важную роль в диагностике сахарного диабета. Исследование рекомендуется регулярно проводить всем людям старше 45 лет, так как изменение данного показателя при развитии сахарного диабета происходит раньше, чем возникают первые клинические признаки заболевания. Определение уровня глюкозы используется для выявления патологий щитовидной железы, надпочечников, гипофиза, причин ожирения и осложнений беременности.

Повышение концентрации глюкозы (гипергликемия) наблюдается при сахарном диабете, нарушении толерантности к глюкозе, остром и хроническом панкреатите, инфаркте миокарда, кровоизлиянии в мозг, эндокринных заболеваниях (гигантизме, акромегалии, феохромоцитоме, муковисцидозе, тиреотоксикозе), хронических заболеваниях почек и печени, приеме ряда лекарственных средств (кофеина, глюкокортикостероидов, эстрогенов, тиазидов), а также в период беременности.

Физиологическая гипергликемия возможна при физических и/или психических нагрузках, стрессовых ситуациях.

Накануне забора крови необходимо исключить употребление жирной и жареной пищи, кофе, крепкого чая и спиртных напитков. Следует избегать физических и психических нагрузок.

Снижение уровня глюкозы крови (гипогликемия) может служить признаком новообразований поджелудочной железы, выраженных поражений печени (гепатит, цирроз, опухоль), эндокринных заболеваний (гипопитуитаризм, болезнь Аддисона, адреногенитальный синдром), приема некоторых препаратов (амфетамина, анаболических стероидов, инсулина, антигистаминных средств). Гипогликемия сопровождает отравления хлороформом, мышьяком, алкогольную интоксикацию, кроме того, она свойственна недоношенным детям.

Читайте также:

6 основных причин повышенного артериального давления

8 продуктов, помогающих улучшить кровообращение

Донорство органов в России: 8 особенностей, о которых нужно знать

Общий холестерин

Общий холестерин (холестерол) – это компонент жирового обмена, который участвует в выработке половых гормонов, витамина D и построении клеточных мембран.

Помимо общего холестерина при проведении биохимического анализа крови обычно определяют также концентрацию липопротеинов высокой плотности, липопротеинов низкой плотности и триглицеридов. Совокупность указанных показателей называется липидограммой. В зависимости от цели исследования при проведении биохимического анализа могут определяться все показатели липидного профиля или некоторые из них.

Повышение общего холестерина относится к факторам риска развития атеросклероза и сердечно-сосудистых патологий. Увеличение холестерина в крови наблюдается при заболеваниях печени, почек, поджелудочной железы, сахарном диабете, гипотиреозе, подагре, хроническом алкоголизме, ожирении, а также употреблении в пищу большого количества жиров и углеводов.

Снижение общего холестерина происходит при нарушении всасывания в кишечнике, патологиях печени, ревматоидном артрите, острых инфекционных заболеваниях, гипертиреозе.

Общий билирубин

Билирубин – это желчный пигмент, который является продуктом разложения гемоглобина. Билирубин продуцируется в селезенке и костном мозге при распаде эритроцитов, является компонентом желчи.

При необходимости повторных исследований рекомендуется сдавать анализы в той же лаборатории с максимально похожими условиями подготовки.

Общий билирубин это сумма прямого и непрямого билирубина. В ряде случаев помимо общего билирубина требуется определение его фракций.

Определение концентрации билирубина имеет диагностическое значение при подозрении на гепатит, цирроз, новообразования печени, желчнокаменную болезнь, гемолитическую анемию, дефицит витамина В12.

Повышение общего билирубина происходит при холестатическом гепатите, метастатическом раке печени, первичном билиарном циррозе, синдроме Жильбера, В12-дефицитной анемии, глистных инвазиях, отравлении мухоморами. Во время беременности повышение билирубина может служить признаком изгиба желчного протока.

Значительное повышение концентрации билирубина в крови проявляется желтухой, что выглядит как окрашивание кожных покровов, видимых слизистых оболочек и склер в желтый цвет.

Понижение билирубина происходит при соблюдении низкокалорийной диеты, голодании.

Аланинаминотрансфераза

Аланинаминотрансфераза (АЛТ, АлАТ) – это эндогенный фермент подгруппы аминотрансфераз, участник обмена аминокислот. В большом количестве содержится в печени и почках, в меньшем – в сердечной мышце, скелетной мускулатуре, селезенке, легких, поджелудочной железе. При разрушении клеток данных органов в результате каких-либо патологических процессов аланинаминотрансфераза выделяется в кровь.

Определение уровня аланинаминотрансферазы важно для выявления заболеваний печени, патологий миокарда, оно используется в обследовании контактных лиц из очага вирусного гепатита и доноров, а также для контроля терапии гепатита.

АЛТ повышается при панкреатите, шоковом состоянии, травмах скелетных мышц, ожогах, обширном инфаркте миокарда, сердечной недостаточности, вирусных гепатитах, токсическом поражении печени, циррозе, раке печени, алкоголизме, применении ряда лекарственных средств (психотропные препараты, контрацептивы, антибактериальные средства, иммунодепрессанты, средства для химиотерапии и пр.).

Не рекомендуется сдавать кровь на биохимический анализ после проведения физиотерапевтических процедур и рентгенологического исследования.

В случае тяжелых поражений печени уменьшается количество клеток, вырабатывающих АЛТ, концентрация его в крови может снижаться – это наблюдается при циррозе, некрозе печени. Также уровень фермента снижается при гиповитаминозе В6.

Аспартатаминотрансфераза

Аспартатаминотрансфераза (АСТ, АсАТ) – эндогенный фермент, еще один участник обмена аминокислот, содержится в печени, почках, сердце, скелетной мускулатуре, селезенке, поджелудочной железе, легких и нервной ткани. При развитии инфаркта миокарда активность данного фермента может повышаться в 20 раз, что обнаруживается еще до появления ЭКГ-признаков и используется в ранней диагностике инфаркта.

Исследование АСТ имеет значение для диагностики патологий печени, сердца и скелетной мускулатуры.

Повышение показателя происходит при тромбозе легочной артерии, остром ревмокардите, инфаркте миокарда, оперативных вмешательствах на сердце, стенокардии, гепатитах, холестазе, раке печени, панкреатите, травмах скелетных мышц.

Снижение АСТ наблюдается при тяжелых поражениях печени, недостатке витамина В6. При разрыве печени значение аспартатаминотрансферазы, как правило, определяет прогноз – неблагоприятным прогностическим признаком служит резкое снижение уровня АСТ и АЛТ при наличии гипербилирубинемии.

Мочевина

Мочевина – это основной конечный продукт распада белков, вырабатываемый печенью и выводящийся преимущественно почками. Концентрация мочевины в крови изменяется не только при патологических процессах в организме, но также зависит от некоторых физиологических факторов (питание, физические нагрузки, возраст) и приема лекарственных средств.

У детей первых дней жизни уровень мочевины в крови соответствует таковому у взрослых, у детей более старшего возраста нормальные значения несколько ниже, что учитывается при расшифровке биохимического анализа крови.

Повышение общего холестерина относится к факторам риска развития атеросклероза и сердечно-сосудистых патологий.

Повышение концентрации мочевины в крови происходит при обезвоживании организма, нерациональном питании (избыточном употреблении белка), усиленном разрушении белка, гломерулонефрите, пиелонефрите, туберкулезе почек, сердечной недостаточности, шоковых состояниях, сильных кровотечениях, ожогах, кишечной непроходимости, аденоме простаты, камнях в мочевом пузыре, лихорадке. Краткосрочное повышение уровня мочевины наблюдается при интенсивных физических нагрузках.

Снижение данного показателя наблюдается во время беременности, после гемодиализа, при тяжелых поражениях печени (острая гепатодистрофия, гепатиты, цирроз), повышенной утилизации белка, недостаточности или отсутствии ферментов, принимающих участие в цикле образования мочевины, недостаточном употреблении белка (при вегетарианстве, голодании), отравлении мышьяком, фосфором.

Креатинин

Креатинин – еще один конечный продукт обмена белков, который продуцируется в печени и принимает участие в выработке энергии при мышечных сокращениях, выводится из организма с мочой. В организме здорового человека этот процесс происходит постоянно, поэтому уровень данного показателя, как правило, определяется объемом мышечной массы. Следовательно, у мужчин концентрация креатинина выше, чем у женщин, а у детей изменяется по мере взросления. Определение уровня креатинина в крови необходимо для оценки функции почек, определения патологий скелетных мышц.

Кровь для биохимического анализа сдают из вены, утром и натощак

Повышение уровня креатинина происходит при несбалансированном питании (преобладание в рационе мясной пищи), дегидратации организма, избыточной мышечной массе, сильном внутреннем кровотечении, острой и хронической почечной недостаточности, приеме некоторых лекарственных средств (цефалоспоринов, андрогенов, салицилатов, аминогликозидов, барбитуратов), травмах, оперативных вмешательствах, синдроме длительного сдавливания, воздействии на организм ионизирующего излучения.

Помимо исследования крови в ряде случаев проводится биохимический анализ других биологических жидкостей пациента.

Снижение креатинина может указывать на атрофию мышц, вегетарианский тип питания, гипергидратацию, прием кортикостероидов. Также он понижен в период беременности и у людей преклонного возраста.

Альфа–амилаза

Альфа-амилаза (амилаза, диастаза) – пищеварительный фермент, который расщепляет углеводы пищи, синтезируется в поджелудочной железе и слюнных железах и выводится почками. У детей первого года жизни нормальные значения альфа-амилазы низки, так как в их рацион не входят сложные углеводы.

Определение концентрации данного фермента используется в ходе диагностики панкреатита (острого или обострения хронического), муковисцидоза, выявления причин острых абдоминальных болей.

Повышение уровня альфа-амилазы наблюдается при панкреатите, кисте поджелудочной железы, остром перитоните, почечной недостаточности, сахарном диабете, холелитиазе. Снижение – при гепатите, недостаточности поджелудочной железы, токсикозе беременности, муковисцидозе, панкреатэктомии.

Кальций

Кальций – это электролит крови, который способствует поддержанию гемостаза, нормального сердечного ритма, участвует в нервной проводимости, формировании костей, минерализации зубов и многих других процессах в организме.

Значительное повышение его концентрации отмечается при злокачественных новообразованиях с поражением костей, обезвоживании, острой почечной недостаточности, тиреотоксикозе.

Снижение содержания кальция наблюдается при рахите, хронической почечной и печеночной недостаточности, панкреатите.

Железо

Железо в организме – это электролит, чьей основной задачей является связывание, перенос и передача кислорода тканям, т. е. их питание.

Определение концентрации билирубина имеет диагностическое значение при подозрении на гепатит, цирроз, новообразования печени, желчнокаменную болезнь, гемолитическую анемию, дефицит витамина В12.

Повышенная концентрация железа в крови характерна для заболеваний печени, острой лейкемии, отравления свинцом. Также наблюдается при приеме некоторых препаратов и избыточном поступлении с пищей.

Снижение железа наблюдается при железодефицитной анемии, инфекционных заболеваниях, гипотиреозе, заболеваниях печени и почек, значительных кровопотерях.

Магний

Магний необходим для нормального обмена веществ, функционирования сердца, нервной и мышечной ткани.

Повышение его концентрации происходит при дегидратации, почечной недостаточности, гипотиреозе.

Если отмечается снижение уровня магния, значит, имеет место нарушение поступления или усвоения микроэлемента. Это встречается при панкреатите, гипертиреозе, алкоголизме, почечной недостаточности.

Перечисленные показатели – основные. В случае необходимости при проведении биохимического анализа могут определяться и некоторые другие.

Видео с YouTube по теме статьи:

Как расшифровать биохимический анализ крови: норма показателей

Зачем нужен биохимический анализ крови

Смысл биохимического анализа крови (БАК) можно объяснить в двух словах. Если общий анализ крови (ОАК) даёт представление о состоянии организма в целом, то БАК добавляет подробностей — сообщает , здоровы ли конкретные органы и системы.

Биохимический анализ крови помогает обнаружить болезни печени, почек, диабет и другие недуги.

Кроме того, БАК позволяет выяснить, всё ли в порядке с уровнем сахара в крови, обменом веществ и каких важных витаминов, микро- и макроэлементов, гормонов, ферментов не хватает организму для нормальной работы.

Что показывает биохимический анализ крови

Лаборант возьмёт у вас несколько миллилитров крови из вены. Это обязательно делается натощак — через 8–12 часов после последнего приёма пищи. Затем взятый образец исследуют в поисках нескольких ключевых компонентов. Их разделяют на группы .

Глюкоза

Или уровень сахара в крови. Глюкоза — это источник энергии для клеток организма. Тело регулирует её количество в крови с помощью различных гормонов (например, инсулина) и ферментов. Если сахара слишком много или мало, значит, с эндокринной или выделительной системой происходит что‑то не то.

Белки

  • Альбумин. Это белок, который вырабатывается печенью. Плазма крови примерно на 60% состоит из альбумина.
  • Общий белок. В крови насчитывается несколько десятков различных белков. Общий белок — это усреднённое суммарное их количество.
  • Специфические белки. Это отдельные виды белков крови, изменение уровня которых может быть связано с серьёзными заболеваниями. К специфическим относятся, в частности, С‑реактивный белок (он сигналит об остром воспалительном процессе в организме), ферритин (нужен для нормального усвоения железа), миоглобин (создаёт необходимый запас кислорода в мышцах, включая сердечную), ревматоидный фактор (антитела, которые вырабатываются только при серьёзных заболеваниях: инфекционных, мышечной и соединительной тканей, аутоиммунных, онкологических и других). Анализ на специфические белки далеко не всегда входит в стандартный БАК. Если врач хочет выяснить содержание конкретного вещества в крови, он напишет об этом в направлении на исследование.

Липиды

Так называемая липидная панель позволяет проверить уровень различных видов холестерина.

  • Липопротеины высокой плотности (ЛПВП). Это так называемый хороший холестерин, который удаляет вредные вещества из крови и помогает печени расщеплять их.
  • Липопротеины низкой плотности (ЛПНП). Речь о «плохом» холестерине, который вызывает образование бляшек в сосудах и повышает риск сердечно‑сосудистых заболеваний.
  • Общий холестерин. Сумма значений «хорошего» и «плохого».

Печёночные тесты

Так называют оценку уровня некоторых ферментов, связанных с состоянием печени.

  • Общий билирубин. Это оранжево‑жёлтый пигмент, который образуется при разрушении гемоглобина. Билирубин токсичен, поэтому в норме печень быстро выводит его из организма. Но если гемоглобин разрушается слишком активно или печень не справляется с нормальными объёмами билирубина, уровень пигмента в крови резко растёт. Это нередко проявляется и внешне — пожелтением кожи и белков глаз (желтухой).
  • Аланинаминотрансфераза (АлАт, АЛТ). Печёночный фермент, необходимый для аминокислотного обмена. Его уровень растёт при повреждениях печени.
  • Аспартатаминотрансфераза (АсАт, АСТ). Ещё один фермент, который выбрасывается в кровь при серьёзных нарушениях в работе печени.
  • Фосфатаза щелочная. Это фермент, участвующий в фосфорном обмене. Его повышение тоже является маркером проблем с печенью.

Почечные тесты

  • Креатинин. Это продукт жизнедеятельности, который образуется в мышцах. Из крови его выводят почки, поэтому уровень креатинина является хорошим показателем работы этого парного органа.
  • Мочевая кислота. Образуется в печени и опять‑таки выводится из крови почками. Если они не справляются (или, напротив, нездорово активны), уровень мочевой кислоты в крови растёт (или падает).
  • Мочевина. Тоже образуется в печени, где происходит распад белков, и выводится из крови почками.

Неорганические вещества (минералы, электролиты) и витамины

  • Кальций. Один из важнейших минералов в организме. Без него невозможна нормальная работа мышц, нервов, сердца. Кроме того, он критически важен для развития и восстановления костей.
  • Натрий. Отвечает за передачу нервных импульсов и помогает усваивать кальций.
  • Магний. Как и натрий, активно задействован в передаче нервных импульсов.
  • Хлор. Помогает регулировать количество жидкости в организме и поддерживать кислотно‑щелочной баланс.
  • Калий. Критически важен для нормальной работы сердца.
  • Железо. Необходимо для доставки кислорода к органам и тканям.
  • Фосфор. В нём очень нуждаются нервная, мышечная и костная системы.
  • Фолиевая кислота. Участвует в огромном количестве процессов в организме — от усвоения аминокислот и глюкозы до производства крови.
  • Витамин В12. Крайне важен для производства красных кровяных телец — эритроцитов.

Каковы нормы показателей крови при БАК

Бланк с результатами биохимического анализа крови, как правило, представляет собой таблицу из трёх столбцов. В первом — название показателя, во втором — диапазон его нормальных значений, в третьем — ваш результат.

Чтобы свериться с нормой, ориентируйтесь прежде всего на цифры, указанные на выданном вам бланке. Дело в том, что лаборатории проводят тесты на разных реактивах и при различных условиях. Поэтому диапазоны оптимальных значений могут несколько варьироваться в зависимости от организации, которая обрабатывала ваш анализ. Для вас важно только одно: проверить, попадает ли результат в границы норм, установленные конкретной лабораторией.

Цифры ниже ознакомительные для наиболее распространённых показателей.

Показатель Норма для взрослого человека
Глюкоза 3,9–5,6 ммоль/л
Альбумин 34–54 г/л
Общий белок 60–83 г/л
Холестерин ЛПВП 40 мг/дл и выше — для мужчин; 50 мг/дл и выше — для женщин
Холестерин ЛПНП Менее 100 мг/дл
Общий холестерин 125–200 мг/дл
Общий билирубин 1,71–20,5 мкмоль/л
АлАт, АЛТ 4–36 ед./л
АсАт, АСТ 8–33 ед./л
Фосфатаза щелочная 20–140 ед./л
Креатинин 74–107 мкмоль/л
Мочевая кислота 3,5–7,2 мг/дл
Мочевина 2,5–7,1 ммоль/л
Кальций 2,2–2,7 ммоль/л

Как расшифровать биохимический анализ крови

Это может и должен делать только врач, выдавший вам направление на анализ. По той причине, что на биохимию крови влияет много разных факторов.

Так, повышенный уровень глюкозы в крови может быть как симптомом преддиабета или диабета, так и признаком того, что вы безответственно отнеслись к анализу и, положим, выпили перед ним сладкий кофе.

Есть и другие примеры. Повышенные показатели печёночных проб — маркер гепатита, а иногда и цирроза. Но в то же время АЛТ и АСТ могут расти, если вы лечитесь от бактериальной инфекции, принимая антибиотики и другие препараты. Сниженный уровень мочевины — признак серьёзного поражения печени. Или банального недоедания, если вы сидите на строгой диете.

В общем, ещё раз повторим. Расшифровывать БАК должен только наблюдающий вас врач. Самостоятельно разбирать результаты анализов и тем более начинать на их основе самолечение — недопустимо.

Читайте также 💊💉💊

Теория биохимических систем: обзор

Теория биохимических систем (BST) - это основа для набора аналитических инструментов и инструментов моделирования, которые облегчают анализ динамических биологических систем. В этом документе описываются основные разработки BST до текущего состояния в 2012 году. В нем обсуждается его обоснование, описываются типичные стратегии и методы проектирования, диагностики, анализа и использования моделей BST, а также рассматриваются области применения. Работа предназначена как руководство для исследователей, начинающих увлекательную область анализа биологических систем, и как ресурс для практиков и экспертов.

1. Преамбула

Теория биохимических систем (BST) - это математическая и вычислительная основа для анализа и моделирования систем. Первоначально он был разработан для биохимических путей, но к настоящему времени стал гораздо более широко применяться в системах в биологии и за ее пределами. BST называется «каноническим», что означает, что построение модели, диагностика и анализ следуют строгим правилам, которые будут обсуждаться в этой статье. Ключевой компонент BST - это степенное представление всех процессов в системе.

BST был в центре внимания ряда книг [1–6], в том числе некоторых на китайском и японском языках [7–9]. Наиболее подробный современный текст, посвященный BST, - это [3]. Более того, с момента его создания, многочисленные обзоры отражают эволюцию современного состояния BST. В большинстве этих обзоров обобщены методические достижения в области анализа систем биохимических путей [10–50]. Другие сравнивали модели BST с альтернативными моделями [32, 51–63]; некоторые из этих сравнений будут обсуждены позже.Тем не менее, другие обзоры были сосредоточены на специальных областях, таких как индивидуальные методы оптимизации моделей BST (например, [64–67]) или оценка их параметров (например, [68–72]), стратегии для открытия дизайна и принципов работы в естественных системах ( например, [73–78]), и даже использование BST-моделей в статистике [79–81]. Исторический отчет о первых двадцати годах BST представлен в [82].

Поддерживая методологические разработки в этой области, было разработано несколько пакетов программного обеспечения для различных аспектов анализа BST.Самым ранним из них был ESSYNS [83–85], который поддерживал все стандартные стационарные анализы, а также содержал численный решатель, который в то время был во много раз быстрее любого стандартного программного обеспечения [86, 87]; см. также [88]. Используя достижения в области вычислений и расширение решателя от ESSYNS, Феррейра создал очень удобный для пользователя пакет PLAS, который находится в открытом доступе и до сих пор широко используется [89] (см. Также [3]). Ямада и его коллеги разработали программное обеспечение для перевода моделей E-клеток в модели BST в формате PLAS [90].Группа Окамото создала программное обеспечение BestKit, которое позволяет графическое проектирование и перевод моделей, а также их анализ [91–93]. Вера и его коллеги разработали программный инструмент PLMaddon для анализа моделей BST в SBML [94]; см. также [95]. Он расширяет Matlab SBToolbox специфическими функциями для степенных представлений, которые являются фундаментальными для BST. Похожую цель преследовала программа SBML squeezer, в состав которой входит BST, но носит более общий характер [96]. Другой программный пакет - Cadlive, который предлагает комплексные вычислительные инструменты для построения, анализа и моделирования крупномасштабных моделей биологических сетей [97].Вера и Торрес [98] создали программное обеспечение специально для оптимизации моделей на основе BST, а группа Саважо разработала специальный набор инструментов для анализа пространств проектирования; его можно найти в [99]. Goel et al. предложил автоматизированный метод построения уравнений BST на основе информации о связности и регулировании системы [45].

Цель этой статьи - описать современное состояние BST. Учитывая, что BST была задумана более сорока лет назад, многое произошло и просачивается еще больше.Этот документ является довольно всеобъемлющим, но отнюдь не полным, и вполне вероятно, что некоторые важные статьи отсутствуют, за что я приношу свои извинения. Кроме того, из-за своей широкой области применения в статье можно лишь поверхностно обсудить многие из соответствующих тем, и многие интересные тонкости не станут очевидными и вместо этого «исчезнут» в группах ссылок. Примерами являются подробные исследования принципов построения сетей регуляции генов и выводы об их топологии и регуляции.Тем не менее, ожидается, что статья предоставит новичкам легкий доступ к BST и предоставит более опытным исследователям ценный ресурс.

2. История и обоснование

BST был предложен М. Саважо в 1969 году [100–102]. Несколько интересных тенденций побудили его разработать этот новый формализм. Во-первых, биохимия находилась в процессе перехода от традиционных исследований изолированных реакций к анализу путей и, в частности, к исследованиям роли ингибирования обратной связи в их регуляции и контроле.Как отметил Саважо [101], «теперь мы можем попытаться описать поведение биохимических систем в терминах компонентных реакций. Однако до сих пор не предложено никакого метода системного анализа, который учитывал бы особую нелинейную природу биохимических систем ».

Одновременно с этим важным достижением в биохимии произошло развитие вычислительной техники, и первые пионеры анализа биохимических систем, такие как Дэвид Гарфинкель, представили крупномасштабные системы компьютерного моделирования для выяснения метаболических путей (например,г., [103–105]). Безграничная мощь новых компьютеров казалась пределом для всех, и казалось, что анализ любой большой реакционной системы с помощью моделирования был лишь вопросом времени. Увы, Саважо и другие современники сразу же осознали, что вычислительная мощность - это лишь один из аспектов анализа биологических систем: даже если бы можно было написать алгоритмы для моделирования больших реакционных сетей, было бы совсем не ясно, какие функции следует использовать. Возможно, можно было бы прибегнуть к функциям по умолчанию, таким как законы скорости Михаэлиса-Ментен или Хилла и их обобщения [106–108], но тогда было бы чрезвычайно сложно определить все кинетические константы и коэффициенты.В самом деле, Шульц [109] убедительно показал, что точное представление реакций, катализируемых ферментами, становится на удивление сложным даже для очевидных простых бисубстратных двухпродуктовых реакций, если попытаться правильно объяснить динамику всех промежуточных комплексов. Предостережение против больших моделей ad hoc под другим углом, Генрих и Рапопорт [110, 111] отметили, что сложные имитационные модели реакционных сетей очень затрудняют различение важных и неважных эффектов, которые ферменты и метаболиты оказывают на систему.Иначе говоря, становится сложной задачей сделать вывод только на основе моделирования, какие компоненты системы отвечают за определенные системные реакции. Напротив, утверждалось, что если можно будет найти действительно эффективный математический подход, он позволит относительно простые вычисления собственных значений, чувствительности, выигрыша и других ключевых характеристик модели. Интересно, что эти ключевые характеристики часто определяются значительно сокращенным числом основных параметров, что еще больше повышает привлекательность моделей, облегчающих описание ключевых факторов модели.

Возникшие сложности с чистым подходом к моделированию подсказали поиск альтернативных представлений, который должен был основываться на вызывающих зависть парадигмах физики и инженерии. Физика прочно опирается на теорию, и представления двух связанных маятников или электрической цепи предписываются этой теорией и поэтому по существу однозначны. Кроме того, определяющие параметры, такие как сопротивление и проводимость в электрической цепи, обычно можно измерить.Не так в биологии. Представьте себе ситуацию, когда гормон вызывает изменение экспрессии генов. На первый взгляд, мы сталкиваемся с простой причинно-следственной связью. Однако в деталях этот процесс чрезвычайно сложен. Гормон, высвобождаемый отправителем, например железой, должен найти свои клетки-мишени. Там он должен состыковаться с рецептором. Рецептор обычно представляет собой трансмембранный белок, который при стыковке с гормоном претерпевает некоторые очень специфические изменения в своей трехмерной структуре. Это изменение во вторую очередь служит стимулом для сигнального каскада, который сам по себе включает несколько белков.Белок в последнем слое каскада прямо или косвенно сигнализирует о перемещении или активации фактора транскрипции, который связывается с соответствующей регуляторной областью гена, экспрессия которого должна быть повышена или понижена. Формулировать эту цепочку событий механистически, в биофизических или молекулярных деталях в настоящее время невозможно.

Второй ролевой моделью для потенциальных представлений в биологии была инженерия. Здесь подавляющим выбором является линейная модель.Ни один формализм не понимается так хорошо, как линейная математика, и в частности линейная алгебра, и репертуар аналитических и вычислительных методов не имеет себе равных. Более того, инженерам удалось разработать устройства таким образом, чтобы их характеристики действительно были линейными, по крайней мере, приблизительно. Успех инженерии и ее использования линейной математики очевиден повсюду. Можно подумать только об исследовании Марса, где ракеты в точности следовали компьютерным предсказаниям, чтобы доставить марсоход размером с автомобиль, который самостоятельно передвигается и отправляет обратно снимки ранее невообразимого качества.

К сожалению, инженерные принципы редко могут быть применены непосредственно к биологическим системам, потому что биология по своей сути отличается от инженерии. Не мы, люди, создаем компоненты и объединяем их в функционирующие машины с приблизительно линейными характеристиками. Вместо этого в природе появилось очень много известных и пока что неизвестных компонентов, и эти компоненты взаимодействуют плохо охарактеризованными способами, которые почти всегда содержат настоящие нелинейности, которые вряд ли можно спроектировать для упрощения системного анализа.В первоначальном наборе статей о BST Саважо уже описал это фундаментальное различие, заявив, что «малосигнальная» линеаризация совершенно неадекватна, поскольку известно, что динамический диапазон переменных приводит к нелинейной работе биохимических систем »[ 102]. В то же время он признал, что общая нелинейная теория слишком сложна для любого упрощенного анализа [100]. Единственной реалистичной, выполнимой стратегией должен был быть компромисс между общностью и управляемостью, и этот компромисс должен был быть приближением.

Объединив идеи анализа Боде в электротехнике [112] и теории приближений Тейлора, Саважо предложил степенное представление в качестве действительного локального описания процессов в биохимии. Это представление сочетало общность с простотой, оказалось достаточно богатым, чтобы уловить типичные нелинейности, такие как устойчивые колебания [102], ограничивало количество экспериментальных данных, необходимых для описания общих законов скорости, и в целом казалось идеальным для «конечной цели. … Для объяснения поведения крупномасштабных биохимических систем, а не индивидуальных реакций »[100].Действительно, позже стало ясно, что все нелинейности, которые можно сформулировать как обыкновенные дифференциальные уравнения, также могут быть представлены с полной точностью в BST [113].

Прошло более сорока лет, когда были предложены основные идеи BST, что поднимает вопрос о том, остается ли первоначальная цель «объяснения поведения крупномасштабных… систем» [100] неизменной. Выходя за рамки биохимии и метаболизма, можно было бы ответить на этот вопрос, взглянув на зарождающуюся область системной биологии.И действительно, часто декларируемые цели и задачи системной биологии принципиально не отличаются от целей раннего BST. Под общим заголовком «понимание» биологической системы их можно разделить на две категории, которые на первый взгляд кажутся довольно разными, но на самом деле имеют довольно много общего [44]. Первая цель - создание крупномасштабных моделей целой клетки или организма. Такие модели, несомненно, были бы очень полезны в широком спектре приложений, от метаболической инженерии до нацеливания на лекарства и разработки персонализированных симуляторов болезней.Второй тип понимания - это открытие принципов проектирования и работы, которые объясняют, почему конкретная структура или процесс в природе превзошли альтернативы в ходе эволюции [34, 35, 78]. Например, почему подавление конечного продукта почти всегда нацелено на первый шаг в линейной цепочке процессов? Почему одни гены контролируются индукторами, а другие - репрессорами? Очевидно, что для достижения первой цели реалистичных симуляторов требуются очень большие модели с множеством процессов и параметров, в то время как вторая цель предполагает удаление любой посторонней информации до тех пор, пока сущность структуры или процесса не будет раскрыта в относительно небольшой модели.Тем не менее, на глубоком организационном уровне цели являются двумя сторонами одной и той же проблемы, потому что большинство больших систем в биологии являются модульными и, возможно, обладают общими конструктивными особенностями на разных уровнях. Они организованы и управляются иерархически, так что истинное понимание все более мелких функциональных модулей значительно улучшает понимание системы в целом.

Таким образом, основные цели и стремления BST по-прежнему актуальны, с расширением сферы применения на биологические системы в целом.Методы анализа, конечно, эволюционировали, и теперь стало возможным, например, оценивать S-системы с помощью моделирования миллионов прогонов Монте-Карло, что несколько десятилетий назад можно было выполнить только на нескольких компьютерах по всему миру. . Не менее важно и быстро расширяющаяся доступность биологических технологий, а также огромное количество полезных количественных данных, которые они предоставляют. В сочетании с гораздо более высокой оценкой вычислительных подходов среди экспериментальных биологов существует беспрецедентная уверенность в том, что мы действительно сможем сформулировать и параметризовать очень большие модели биологических систем в обозримом будущем и использовать эти модели на благо человечества.

Истинным Святым Граалем системной биологии будет теория биологии. Легко увидеть, на что способна такая теория, когда мы изучаем переход физики от экспериментальной науки к науке, основанной на теории. Вместо того, чтобы изучать одно приложение за раз, мы могли бы делать (и доказывать) общие утверждения о целых классах биологических явлений. Некоторые биологические законы и частичные теории уже были предложены, но их мало и они изолированы в определенных нишах. Например, почти универсальный закон соответствия между аминокислотами и кодонами оказал огромное влияние на интерпретацию геномной информации, а теория эволюции помогла нам объяснить родство и различия между видами.Теория спроса [114, 115] объясняет различные способы регуляции генов, а теория множественного равновесия и согласованности [116, 117] рассматривает определенные явления в метаболизме. Тем не менее, несмотря на то, что были сделаны некоторые попытки, общие теории более крупных биологических областей кажутся недоступными на данный момент.

3. BST и другие канонические подходы к моделированию

Ключом к пониманию крупномасштабных систем в биологии посредством моделирования является эффективный компромисс между применимостью, точностью представления, математической управляемостью и эффективными вычислительными инструментами.Как следует из термина «компромисс», не известно идеальной стратегии моделирования, которая удовлетворяла бы всем четырем критериям во всех соответствующих ситуациях. Тем не менее, нетрудно понять, что модели, состоящие из чрезвычайно разнородных смесей функций и подмоделей, хотя и могут быть весьма точными, вряд ли позволят обтекаемые формулировки и анализ или четкие интерпретации. Напротив, однородные модельные структуры обеспечивают высокий потенциальный уровень управляемости и элегантности, особенно если для этих структур можно использовать мощные инструменты, такие как линейная алгебра.Признавая этот факт, некоторые подходы к анализу биологических систем использовали «канонические представления» [2, 6, 11, 17, 81, 118]. Они состоят из математически однородных структур, которые являются результатом строгих правил построения, которые, в свою очередь, строго выводятся из математической теории.

Наиболее понятной канонической моделью является линейное представление. При настройке линейной модели с самого начала ясно, что каждый процесс в модели должен быть представлен линейной функцией и что конечный результат будет полностью состоять из таких линейных функций.Наградой за это серьезное ограничение выбора и построения модели является то, что для анализа доступен обширный набор эффективных методов. Именно это богатство методов, например, продвинуло инженерию до невероятного уровня сложности, о котором мы говорили ранее. Как только один компонент модели становится нелинейным, однородность теряется, и упрощенный анализ затрудняется, если не исключен.

Хотя линейные модели по праву являются первым выбором для моделирования, они, очевидно, не учитывают нелинейности, а поскольку биологические явления преимущественно нелинейны, линейные модели не могут напрямую применяться к биологическим системам.Однако мы увидим, что некоторые нелинейные канонические модели обладают линейными характеристиками, которые позволяют анализировать определенные аспекты нелинейных систем. Таким образом, возникают два вопроса: можем ли мы идентифицировать эффективные нелинейные канонические модели, и если да, то стоит ли затраченных усилий на полученные результаты? Начнем со второго вопроса о том, почему выгодно принимать ограничения канонических моделей. Можно дать несколько дополнительных ответов.

Во-первых, канонические модели напрямую решают фундаментальный вопрос о том, как начать проектирование модели.Как указано выше, мы обычно не знаем биофизических процессов и математических функций, которые оптимальны для описания сложных процессов в биологии. Одним из ответов сообщества моделирования было использование моделей по умолчанию или специальных формулировок , которые по какой-то причине кажутся полезными, даже если они могут не иметь биофизической или химической основы и даже если необходимые допущения на самом деле неверны. Например, стандартным представлением реакций, катализируемых ферментами, является функция Михаэлиса-Ментен [106–108], хотя биохимические предположения, лежащие в основе использования этой функции, обычно не выполняются для метаболических путей in vivo [4, 12, 13 ].В то же время эта функция использовалась для изучения процессов, которые мало связаны с ферментами или биохимией, например, поглощение питательных веществ из почвы через корни [119]. В канонических подходах представление такого процесса формально предписано и даже в некоторых пределах гарантировано будет правильным.

Во-вторых, результатом проектирования канонической модели по определению является модель с однородной структурой, которая позволяет проводить анализ, практически не зависящий от размера модели.Подобно случаю линейных моделей, например, канонические модели Лотки-Вольтерры и модели S-системы в BST позволяют проводить прямой анализ устойчивых состояний и их характеристик, независимо от того, сколько переменных задействовано; мы обсудим эту функцию позже. С практической точки зрения однородная структура модели облегчает разработку специализированного программного обеспечения. Такое программное обеспечение может быть адаптировано специально для канонической структуры и оптимизировано уникальными способами, поскольку его не нужно готовить к непредвиденным обстоятельствам, которые часто возникают в моделях ad hoc .Например, численный решатель для систем степенных дифференциальных уравнений не должен предвидеть возникновение полюсов или других плохо определенных ситуаций и поэтому может быть оптимизирован уникальными способами [85–87]. Точно так же различные эффективные решатели для вычислений чувствительности и краевых задач использовали однородную структуру моделей BST [88, 120–127].

В-третьих, хорошо подобранные канонические модели дают некоторые гарантии относительно их точности. Поскольку они по существу всегда являются результатом определенных приближений, известно, что они точны в какой-то выбранной рабочей точке и очень точны вблизи этой точки.В то же время ясно, что их точность неизвестного качества, если отойти от этой точки. Эта проблема, однако, характерна для всех моделей в биологии и будет обсуждаться позже более подробно в контексте BST.

В-четвертых, канонические модели обладают интересным свойством, которое было названо телескопическими [128]. Поскольку эти модели всегда строятся в соответствии с одними и теми же принципами, конкретный организационный уровень, для которого они предназначены, не имеет значения.Таким образом, независимо от того, представляет ли модель динамику генов, метаболитов, организмов или популяций, структура модели всегда одинакова. Если дополнительный, более подробный модуль создается на более низком уровне, чем модель, его структура гарантированно будет такой же, и результат может быть легко включен в модель на более высоком уровне. Как следствие, канонические модели являются естественной отправной точкой для подходов к многомасштабному моделированию.

Наконец, канонические модели допускают объективные сравнения, потому что они различаются только значениями параметров, но не структурой.Напротив, если нужно сравнить две модели ad hoc , неясно даже, сколько параметров следует учитывать. Например, типичная функция Хилла видимо имеет два параметра (и). Тем не менее, можно было бы считать коэффициент Хилла третьим параметром, который в этой формулировке равен 2, но может быть изменен на другое значение. В более общем плане, объективно сравнивать различные функциональные формы - это почти тривиально. В качестве конкретного примера рассмотрим модель Хилла и обобщенную логистическую модель, которые имеют очень похожие графики, но разные форматы и разное количество параметров (см. Рисунок 1).Две канонические модели одного и того же типа всегда намного более похожи, потому что они имеют одинаковую структуру и типы параметров, что позволяет проводить прямое и справедливое сравнение моделей одного и того же размера и даже вложенных моделей, которые включают все больше и больше параметров [129] .


Все канонические модели имеют определенную привлекательность с концептуальной точки зрения, но разные варианты выбора моделей имеют свои истинные преимущества и недостатки, и, как всегда, все они представляют собой различные компромиссы в отношении структурной пригодности, точности, математической пригодности. и вычислительная управляемость, сложность, количество их параметров и множество других функций.Хотя в этой статье основное внимание уделяется BST, следует упомянуть альтернативные канонические подходы, использующие обыкновенные дифференциальные уравнения (ОДУ).

Прежде чем мы подробно обсудим альтернативные канонические модели, полезно ввести общую номенклатуру. Мы различаем два типа переменных. Зависимые переменные , возможно, подвержены влиянию системы и могут изменяться со временем. В системе дифференциальных уравнений каждая зависимая переменная имеет собственное уравнение. Независимые переменные либо постоянны, либо следуют динамике, управляемой извне.Как правило, у них нет собственных уравнений. Примерами являются яркость и температура во время цикла день-ночь, режим кормления, управляемый извне, или активность ферментов, которая, как считается, не изменяется во время численного эксперимента. Параметры - это числовые значения, которые определяют специфику модели. Их значения постоянны на протяжении любого данного (вычислительного) эксперимента, но могут изменяться от одного эксперимента к другому. Основные константы , такие как и, иногда используются, но не как явные компоненты модели.

Общий формат моделей ODE для биохимических и различных других биологических систем: Вот вектор зависимых переменных, - стехиометрическая матрица, а - вектор или реакции. Стехиометрическая матрица описывает, какие переменные участвуют в какой реакции [130].

В качестве примера рассмотрим модель системы разветвленных путей, как показано на рисунке 2. Система содержит три зависимые переменные (,, и) и пять реакций. Таким образом, стехиометрическая матрица имеет три строки и пять столбцов и имеет вид Положительные записи соответствуют притокам, а отрицательные записи означают выбросы из пула метаболитов.Большинство записей - это нули и единицы, но другие величины могут учитывать стехиометрию реакций расщепления или слияния. Вектор реакций прямо показывает формат канонической (или неканонической) модели. Например, каждая из них может быть линейной функцией, функцией скорости Михаэлиса-Ментена или Хилла, степенной функцией или каким-либо другим представлением.


3.1. Типы нелинейных канонических моделей
3.1.1. Модели Лотки-Вольтерры

Старейшей и наиболее известной структурой нелинейного канонического моделирования является модель Лотки-Вольтерры (LV), которая обычно описывает взаимодействия между популяциями [131–136].В частности, динамика популяции описывается как сумма одного линейного члена и некоторых или всех бинарных взаимодействий между любыми двумя популяциями, что приводит к формулировке Эта формулировка содержит квадратичный член для переменной в своем собственном уравнении, который часто интерпретируется как термин скученности, который становится важным, когда популяция становится слишком большой. Любой из параметров может быть положительным, отрицательным или иметь значения 0. Если все переменные строго положительны, можно разделить обе части каждого уравнения на, и результатом будет система в формате: где изменение логарифма переменной задается как линейная функция всех переменных.Эта формулировка весьма интригует, поскольку оказывается, что многие нелинейные канонические формы содержат три составляющих: дифференцирование, суммирование и логарифм переменных.

Интересным аспектом является то, что каждая модель LV имеет один и тот же формат, и что единственные различия между двумя моделями - это количество переменных (уравнений) и числовые значения значений параметров. Может сложиться впечатление, что формат сильно ограничивает набор возможных ответов модели.Однако это впечатление ошибочно, и модели LV могут представлять самые сложные нелинейности [21, 134], включая детерминированный хаос. Например, график на Рисунке 3 - это результат работы системы низкого напряжения всего с четырьмя переменными [71, 137, 138].


Хотя модели LV имеют долгую историю в области экологии и очень богаты возможными реакциями, они не подходят для описания биохимических систем. Причина в том, что этот специфический канонический формат несовместим с основными функциями путей ферментативных реакций.В качестве простого общего примера рассмотрим путь, содержащий бимолекулярную реакцию и один сигнал обратной связи, как показано на рисунке 4.


Эта система в общем моделируется как с некоторыми функциями, которые нам не нужно указывать для этой иллюстрации. Формат LV имеет проблемы с некоторыми процессами в этом простом примере. Постоянный ввод в систему несовместим с форматом LV; это должно быть сформулировано в LV как линейная функция от или, соответственно.Реакция от до представляет собой проблему в уравнении, потому что соответствующий член, описывающий образование, должен включать в качестве субстрата, а также ингибитор, но не сам по себе, поскольку не способствует его собственному образованию. Генерацию следует моделировать с помощью члена, содержащего

.

PPT - Введение в анализ биохимических и генетических систем Презентация PowerPoint

  • Введение в анализ биохимических и генетических систем Эберхард О. Войт * и Майкл А. Саважо ** * Департамент биометрии и эпидемиологии Южного медицинского университета Carolina [email protected] ** Департамент микробиологии и иммунологии Мичиганский университет [email protected]

  • Три способа понимания систем • Снизу вверх - молекулярная биология • Сверху вниз - глобальные данные экспрессии • Случайно системы - статистические закономерности

  • Презентация из пяти частей • От редукции к интеграции с приближенными моделями • От карт к уравнениям со степенными законами • Типичный анализ • Оценка параметров • Введение в PLAS

  • Модуль 1: Необходимость для моделей • Научный взгляд на мир • Что представляет интерес • Что важно • Что есть законный • Что будет вознаграждено • Томас Кун • Применил этот анализ к самой науке • Ключевая роль парадигм

  • Парадигмы • Доминирующие парадигмы • Направляет «нормальную науку» • Исключает альтернативы • Сдвиги парадигм • Неразрешенные парадоксы • Кризисы • Возникновение альтернатив • Основные сдвиги называются революциями

  • Редукционистская парадигма • Несомненно, существуют другие темы • Доминирование в большинстве устоявшихся наук • Физика - элементарные частицы • Генетика - гены • Биохимия - белки • Иммунология - объединение сайтов / идиотипов • Развитие - морфогены • Нейробиология - нейроны / передатчики

  • Неотъемлемые ограничения • Редукционист также является «реконструктором» • Проблема: реконструкция проводится редко • Парадоксально, но на пике успеха слабые места становятся очевидными

  • Показания Недостатков • Полный каталог запчастей • 1 0,000 «частей» E.coli • Но все же мы относительно мало знаем об интегрированной системе • Реакция на новые условия? • Реакция на конкретные изменения молекулярной конституции?

  • т X X X X 1 3 4 2 0 1 2 3 4 5 6 7 8. . . Динамика

  • т X X X X 1 3 4 2 0 1 2 3 4. . . или ? Критические количественные отношения

  • Альтернативные разработки ab XXXXXXXX 2 1 1 3 2 3 3 1 c

  • Парадигма новых систем • Сосредоточено на проблемах сложности и организации • Программа неясна, мало задокументированных успехов • На грани сдвига парадигмы

  • Определение системы • Набор взаимодействующих частей, составляющий целое • Подсистемы подразумевают естественные иерархии • Пример:... клетки-ткани-органы-организм ... • Два противоречивых требования • Целостность • Пределы

  • Контрастный комплекс и простой

  • Количественное понимание интегрированного поведения • Фокус глобален, интегративное поведение • Основано по лежащим в основе молекулярным детерминантам • Понимание должно быть относительным

  • Математика • Для бухгалтерского учета • Выявление критических количественных взаимосвязей • Принятие методов из других областей • Разработка новых методов • Необходимость в соответствующем математическом описании компонентов

  • Закон скорости • Математическая функция • Мгновенная скорость • Явная функция переменных состояния, которые влияют на скорость • Проблемы • Общий случай

  • Примеры • v = k1 X1 • v = k2 X1X2 • v = k3 X12.6 • v = VmX1 / (Km + X1) • v = VhX12 / (Kh3 + X12)

  • Проблемы • Сети законов скорости слишком сложные • Алгебраический анализ затруднен или невозможен • Компьютерный анализ проблематичен • Оценка параметров • Глутаматсинтетаза • 8 модуляторов • Требуется 100 миллионов анализов

  • Приближенное значение • Замените сложные функции более простыми функциями • Требуется общее представление для упрощенного анализа реально больших систем • Необходимо принимать неточности • «Законы» - это приближения • e.g., законы газа, законы Ньютона

  • Критерии хорошего приближения • Уловить сущность системы в реальных условиях • Быть качественно и количественно согласованными с ключевыми наблюдениями • В принципе, допускать произвольный размер системы • Быть в целом применимым в данной области представляющих интерес • Охарактеризовать измеримыми величинами • Облегчить соответствие между моделью и реальностью • Иметь математически / вычислительно управляемую форму

  • Обоснование приближения • Естественная организация организмов предполагает упрощения • Пространственные • Временные • Функциональные • Упрощения ограничивают диапазон переменных • В этом диапазоне приближения часто достаточно

  • Пространственные упрощения • Обильно в природных системах • Компартментация часто встречается у эукариот (например, у эукариот).грамм. митохондрии) • Специфичность ферментов ограничивает взаимодействия • Мультиферментные комплексы, каналы, каркасы, реакции на поверхности • Подразумевает обыкновенные, а не дифференциальные уравнения в частных производных

  • Временные упрощения • Значительные различия во времени релаксации • Эволюционный - поколения • Развитие - время жизни • Биохимические - минуты • Биомолекулярные - миллисекунды • Упрощения • Быстрые процессы в устойчивом состоянии • Медленные процессы практически постоянны

  • Функциональные упрощения • Хороший пример - управление с обратной связью • Некоторые пулы становятся фактически постоянными упрощены • Лучше всего показано графически

  • Закон скорости без обратной связи

  • Закон скорости с обратной связью

  • Последствия упрощения • Требуется и обосновано приближение • Инженерное приближение • Успешное использование линейного приближения иология • Процессы не линейны • Требуется нелинейная аппроксимация • Аппроксимация Тейлора второго порядка • Аппроксимация степенного закона

  • Модуль 2: Карты и уравнения • Переход от реального мира к математической модели • Решите, какие компоненты важны • Постройте карта, показывающая, как компоненты соотносятся друг с другом • Переведите карту в уравнения

  • ATP Рибоза 5-P ADP 2,3-DPG PP-Ribose-P Synthetase NAD FAD Другие нуклеотиды PP-Рибоза-P Глутамин амидо-PRT P-Ribosyl-Nh3 ATP, GTP AMP, GMP Дизайн модели IMP: Карты

  • Пример из Genetics

  • X XXX 4 1 2 3 Компоненты карт • Переменные (Xi, пулы, узлы) • Потоки материала (жирные стрелки) • Сигналы (светлые или пунктирные стрелки)

  • X XXXXX 1 2 3 1 2 3 Правила • Стрелки потока указывают от узла к узлу • Стрелки сигналов указывают от узла к стрелке потока Правильно Incorrec t

  • Терминология • Зависимая переменная • Переменная, на которую влияет система; обычно значение изменяется с течением времени • Независимая переменная • Переменная, на которую система не влияет; обычно имеет постоянное значение во времени • Параметр • постоянное системное свойство; е.g., константа скорости

  • Этапы разработки модели 1. Первоначальный эскиз

  • 2. Таблица преобразования

  • 3. Перерисовать график в символических терминах

  • Примеры неоднозначности • Отсутствие учёта удаления (разведения) различий типов • Отказ реагенты • Неспособность учесть молекулярность • Путаница между материалом и информационным потоком • Путаница в состояниях, процессах и логическом следствии • Неизвестные переменные и взаимодействия

  • Неспособность учесть удаление (разбавление)

  • Неспособность Различайте типы мультиреагентов

  • Неспособность учесть молекулярность (стехиометрия)

  • Путаница между потоками материалов и информации

  • Логическое влияние, 9606 9602 9606 Логическое влияние, 9602 9606 Анализировать и уточнять модель • В целом нет согласия • Расхождения предполагают изменения • Стрелки сложения или вычитания • Сложить или вычесть X • Перенумеровать переменные • Повторить всю процедуру • Циклическая процедура • Известный научный метод сделан явным

  • Открытые и закрытые системы X 2 XXX 1 4 5 X 3 X 2 XXX 1 4 5 X 3

  • Переменные вне системы

  • Общее описание системы • Переменные Xi, i = 1,…, n • Исследование изменения в переменные во времени • Изменение = притоки - оттоки • Изменение = dXi / dt • Притоки, оттоки = функции от (X1,…, Xn) • dXi / dt = Vi + (X1,…, Xn) - Vi– (X1,…, Xn)

  • Преобразование карт в уравнения • Определите дифференциальное уравнение для каждой зависимой переменной: dXi / dt = Vi + (X1,…, Xn) - Vi– (X1,…, Xn) • Включить в Vi + и Vi– те и только те (зависимые и независимые) переменные, которые напрямую влияют на приток или отток, r соответственно

  • X XXX 4 1 2 3 Пример: метаболический путь dX1 / dt = V1 + (X3, X4) - V1– (X1) dX2 / dt = V2 + (X1) - V2– (X1, X2) dX3 / dt = V3 + (X1, X2) - V3– (X3) Нет уравнения для независимой переменной X4

  • Пример: Gene Circuitry

  • Загрузить еще....

    Связь между биохимическими и микробиологическими переменными и различиями во вкусе цельной слюны и пленки, выстилающей язык.

    Целью этой работы было исследовать, может ли биологическая пленка, выстилающая язык, играть роль в восприятии вкуса. С этой целью были исследованы пленка на языке и слюна 21 здорового человека с акцентом на микроорганизмы и их основные метаболические субстраты и продукты. Параллельно с этим оценивалась вкусовая чувствительность с помощью теста, недавно разработанного нашей группой, а связи между биологическими и сенсорными данными исследовались с помощью корреляционного подхода.Слюна и пленка на языке значительно различались по биохимическому составу (пропорции глюкозы, фруктозы, сахарозы, молочной, масляной и уксусной кислот) и микробиологическим профилям: по сравнению со слюной пленка на языке характеризовалась значительно более низкими пропорциями Bacteroidetes (p <0,001). ) и его основной род Prevotella (p <0,01) и значительно более высокие доли Firmicutes (p <0,01), Actinobacteria (p <0,001) и рода Streptococcus (p <0.05). Общая вкусовая чувствительность была связана с биологическими переменными в двух компартментах, но переменные, которые оказывались влияющими на слюну (поток, органические кислоты, пропорция Actinobacteria и Firmicutes) и пленка языка (сахара и пропорции Bacteroidetes) не были одинаковыми. Это исследование указывает на две интересные области исследования вкуса: микробиом полости рта и специфические характеристики пленки, выстилающей язык.

    1. Введение

    Пищевое поведение - ключевой фактор здоровья человека: некоторые из основных патологий, влияющих на современное общество, такие как ожирение, сердечно-сосудистые заболевания или диабет 2 типа, как сообщается, тесно связаны с ним.Детерминанты пищевого поведения разнообразны и включают, например, биологические, психологические и социально-экономические факторы. Среди биологических факторов чувство вкуса участвует в сенсорном восприятии пищи и, таким образом, влияет на выбор пищи. Нарушения вкусового восприятия могут, например, приводить к расстройствам пищевого поведения и недоеданию [1]. Вероятно, наиболее объективный способ характеристики и классификации субъектов в соответствии с их вкусовыми функциями - это измерение их вкусовой чувствительности, а точнее их индивидуального порога обнаружения.Таким образом, этот подход широко используется у пациентов с жалобами на ротовую полость [2, 3] или с заболеваниями, связанными с диетой, такими как ожирение [4, 5].

    Восприятие вкуса происходит после активации специализированных рецепторов вкусовых сосочков на языке. Слюна - это основная жидкость, взаимодействующая с пищей, и это среда, омывающая вкусовые рецепторы; таким образом, он играет важную роль в восприятии вкуса посредством нескольких механизмов, таких как защита вкусовых рецепторов или транспорт вкусовых соединений [6].Несколько исследований действительно описали взаимосвязь между составом слюны и вкусовой чувствительностью, например, к горечи [7–9] или вкусу олеиновой кислоты [10]. Помимо свободно текущей слюны, биологическая пленка, выстилающая поверхность языка, еще более тесно контактирует со вкусовыми рецепторами. Многочисленные углубления на спинке языка образуют уникальное экологическое место, которое обеспечивает большую площадь поверхности для скопления слюны, остатков ротовой полости и микроорганизмов [11]. Таким образом, язык покрывается пленкой, содержащей бактерии, шелушащиеся клетки и остаточную слюну.Термин «налет на языке» также используется в литературе, хотя очень часто относится к нежелательному избытку биологического материала. Некоторые исследования связывают налет на языке с восприятием вкуса. Более низкие общие вкусовые характеристики (чувствительность к четырем вкусовым веществам) незначительно наблюдались у пожилых пациентов с налетом на языке [3], а снижение порогов распознавания солености и кислоты наблюдалось у пожилых медсестер после легкого соскоба передней половины языка [12]. Оба случая подтверждают предположение, что пленка, выстилающая язык, может влиять на восприятие вкуса, и мы формулируем гипотезу о том, что, в частности, бактериальный компонент этой пленки заслуживает внимания.Это основано на нескольких прямых или косвенных наблюдениях, предполагающих, что бактерии полости рта могут изменять чувство вкуса. Таким образом, Solemdal et al. [13] установили связь между повышенным содержанием в слюне бактерий Streptococci и Lactobacilli и снижением восприятия кислого вкуса. Мы также обнаружили, что низкая чувствительность к вкусу жирных кислот связана с высокой концентрацией органических кислот, вероятно, бактериального происхождения в слюне [10]. Были упомянуты два возможных механизма: во-первых, более высокая бактериальная нагрузка в пленке языка создаст барьер, ограничивающий доступ молекул вкуса к рецепторам вкуса; во-вторых, метаболизм бактерий может влиять на концентрацию вкусовых веществ (например,g., субстраты, такие как сахара или аминокислоты, конечные продукты, такие как органические кислоты) рядом со вкусовыми рецепторами и, таким образом, изменяют вкусовую чувствительность в соответствии с механизмом сенсорной адаптации.

    В этом контексте это исследование преследовало две основные цели: во-первых, оно было направлено на характеристику состава слюны и пленки языка у здоровых субъектов, уделяя особое внимание микроорганизмам и их основным метаболическим субстратам и продуктам (сахарам и органическим кислотам). Во-вторых, он был направлен на изучение того, связана ли вариабельность этих показателей, особенно профиля микроорганизмов, с вариабельностью чувствительности к пяти основным вкусам (сладкий, кислый, соленый, горький и умами).

    2. Материалы и методы
    2.1. Химические вещества и реагенты

    Фруктоза, лактоза, сахароза, уксусная кислота, пропионовая кислота, масляная кислота и молочная кислота были коммерчески получены от Sigma-Aldrich (Steinheim, Германия). Глюкозу покупали в Merck (Дармштадт, Германия). Праймеры (Eurogentec, Бельгия), использованные для реакции преамплификации (ПЦР), показаны в таблице 1.

    a 27 3

    0 β -Proteobacteria 900w

    o -ProteobTacteria Fuscc -Proteobacteria Veillonella CGTCCCGATTAACAGAGCTT G Devotella и другие., 2011; Pécastaings et al., 2016; Сузуки и др., 2004; Ринттиля и др., 2004; Пикард и др., 2004; Marathe et al., 2012.

    Праймер Олигонуклеотидная последовательность ( - ) Target Ссылка

    SPU Fwd AAACTCAAAKGAATTGACGG Все бактерии a
    SPU Rev G CTCGRC28
    ACT Fwd TACGGCCGCAAGGCTA Actinobacteria a
    ACT Rev TCRTCCCCACCTTCCTCCG Актинобактерии a
    BACT FwdAGAC BACT FwdAGCC BACT Rev GGTAAGGTTCCTCGCGTAT Bacteroidetes a
    FIRM Fwd TGAAACTYAAAGGAATTGACG Firmicutes Firmicutes a
    FIRMCAC
    FIRMCAC
    -P Fwd TCGTCAGCTCGTGTYGTGA γ -Proteobacteria a
    γ -P Rev CGTAAGGGCCATGATG γ
    ACTCCTACGGGAGGCAGCAG β -Протеобактерии b
    β -P Rev TCACTGCTACACGYG β -ProteobTacteria b
    b c
    Fuso Rev TGGTCCTCACTGATTCACACAGA Fusobacterium spp c
    Veil Fwd A (C / T) CAACCTGCCCTTCAGA Veillonella
    Veillonella spp d
    Strep Fwd GTACAGTTGCTTCAGGACGTATC Streptococcus sppTT

    0 Streptococcus sppTT

    e
    Предыдущая Fwd CACCAAGGCGACGATCA Prevotella spp f
    Предыдущая версия GGATAACGCCYGGACCT Prevotella spp f
    f
    2.2. Субъекты и образцы слюны и пленки языка

    Исследование и протоколы были одобрены соответствующим этическим комитетом (Comité de Protection des Personnes Ouest V, n ° 2016-A01954-47). Письменное информированное согласие было получено от участников. В исследовании участвовал 21 здоровый субъект (11 женщин, 10 мужчин в возрасте от 22 до 60 лет), которые заявили, что у них хорошее здоровье полости рта.Точнее, критерии исключения были следующими: курильщики, беременные женщины, люди, страдающие пищевой аллергией, пациенты, длительное время (более одного месяца) принимавшие лекарства, пациенты, которые проходили курс лечения антибиотиками, лечились у зубов или использовали антисептические средства для полоскания рта в предыдущем месяце, субъекты кто когда-либо проходил лучевую терапию головы и шеи, а также страдающие патологиями, поражающими полость рта (например, синдром Шегрена, красный плоский лишай, гингивит). Кроме того, никто из испытуемых не чистил язык в рамках своей рутины гигиены полости рта.Доноры были проинструктированы не есть и не пить по крайней мере за 2 часа до сбора образца, который происходил между 10 и 11 часами утра.Нестимулированная цельная слюна собиралась прямым сливом в 5-миллилитровую пробирку в течение 3 минут. После короткого отдыха сидящие участники проглотили остатки слюны, сразу высунули язык как можно дальше и сохраняли эту позу, пока снимался фильм. Все образцы были собраны одним и тем же экспериментатором. Пленку с языка собирали путем соскабливания языка пластиковой стерильной палочкой от корня до верхушки одним движением соскабливания.Вся процедура отбора проб применялась в течение двух отдельных дней для каждого субъекта. В первый день регистрировали вес и готовили образцы для биохимического и микробиологического анализа. На второй день измеряли pH слюны и образцов пленки сразу после сбора с помощью микроэлектрода (pH-метр IQ240, IQ Scientific Instruments, Карлсбад, Калифорния, США).

    2.3. Определение концентрации сахаров и кислот с помощью ВЭЖХ

    Слюну разбавляли на 1/2 и пленку языка на 1/4 водой Milli Q.Образцы центрифугировали при 15000 g в течение 15 минут при 4 ° C, супернатант дополнительно разбавляли 1:10 и фильтровали через нейлоновый фильтр 0,22 мкм мкм.

    Сахара анализировали с использованием ионно-хроматографической системы Dionex ICS-3000 (Dionex, Саннивейл, США), состоящей из корпуса для хроматографии с градиентным насосом, инжекционной петли 5- мкл и электрохимического детектора. Сахарный состав образца определяли с помощью импульсного амперометрического детектора (PAD) с использованием колонки CarboPac 1 (2 × 250 мм i.d., 5 мм, Dionex) и 100 мМ NaOH в качестве подвижной фазы при скорости потока 0,25 мл / мин.

    Органические кислоты также анализировали с помощью системы ионной хроматографии Dionex ICS-3000 (Dionex, Саннивейл, США), оснащенной детектором электропроводности. Ионную хроматографию проводили на колонке IonPac AS11-HC (Dionex, 4 × 250 мм). Подвижная фаза, 0,8 мМ NaOH, находилась при скорости потока 0,25 мл / мин и при комнатной температуре. Органические кислоты обнаруживали путем химического подавления проводимости с использованием микромембранного подавителя анион-ICE.

    Сахара и органические кислоты были идентифицированы и количественно определены в соответствии со временем удерживания и интенсивностью сигнала эталонных соединений. Стандартные кривые были получены с использованием глюкозы, фруктозы, сахарозы и лактозы в диапазоне концентраций от 0,005 до 2,5 мг / л и лактата, ацетата, пропионата и бутирата в диапазоне концентраций от 0,15 до 37,5 мг / л.

    2.4. Подсчет колониеобразующих единиц (КОЕ)

    Были подготовлены серийные разведения (от 10 -3 до 10 -6 ) разбавленной слюны и образцов пленки, и 100 образцов мкл л были посеяны на среду Columbia (Biokar) с добавками с глюкозой (10 г / л) и 5% (об. / об.) дефибринированной овечьей кровью.Подсчет колоний проводили после инкубации планшетов в двух различных условиях, аэробном и анаэробном (5% CO 2 ), при 37 ° C в течение 48 часов. Общая концентрация культивируемых микроорганизмов была приблизительно определена путем добавления концентраций аэробных и анаэробных микроорганизмов.

    2,5. Экстракция ДНК и qPCR
    Экстракция ДНК

    выполнялась с использованием набора Nucleo-Spin DNA fabric (Macherey-Nagel, Германия), следуя инструкциям производителя с небольшими изменениями; а именно, на стадии лизиса 0.Добавляли 1 стеклянные шарики размером мкм и мкм, и смесь встряхивали на максимальной скорости в течение 10 мин. Качество экстрагированной ДНК определяли с помощью спектрофотометра NanoDrop ND-1000 и гель-электрофореза. ПЦР-амплификации выполняли в трех повторностях в 20 реакционных смесях по мкл и л, содержащих 4 мкл мкл экстракта ДНК, 300 нМ каждого праймера и 10 мкл мкл SsoAdvanced ™ Universal SYBR® Green Supermix (Bio-Rad) в системе обнаружения ПЦР в реальном времени CFX96 (Bio-Rad, США).Условиями термоциклирования были начальная денатурация при 95 ° C в течение 3 минут, затем 40 циклов при 95 ° C в течение 15 секунд и 60 ° C в течение 30 секунд. Эффективность амплификации определяли путем построения стандартной кривой для каждой пары праймеров. Праймеры были выбраны для нацеливания на все бактерии и наиболее репрезентативные типы, классы или роды бактерий полости рта (Таблица 1). Все праймеры нацелены на 16S рРНК, за исключением Streptococcus spp, праймеры которого нацелены на ген tuf . Процент (P) каждой конкретной группы (SPE) определяли относительно общего количества бактерий (SPU) с помощью уравнения: P = (Eff.SPU) / (Eff.SPE) x100, где Eff - эффективность ПЦР-амплификации. Предварительные эксперименты показали, что α -протеобактерий не было обнаружено в микробиоте полости рта. Поэтому результаты для филума Proteobacteria были рассчитаны путем сложения результатов для двух классов β -Proteobacteria и γ -Proteobacteria. Аналогичным образом, результаты для рода Fusobacteria рассматривались как приближение для типа Fusobacteria, потому что это почти исключительно единственный род этого типа, обнаруженный в полости рта [14].

    2.6. Определение показателей вкусовой чувствительности

    Вкусовая чувствительность оценивалась по пяти основным вкусам: сладкому (фруктоза), соленому (хлорид натрия), кислому (лимонная кислота), горькому (гидрохлорид хинина) и умами (глутамат натрия). Все вкусовые добавки были пищевого качества, а в качестве растворителя использовалась деионизированная вода. Для каждого вкуса самые низкие воспринимаемые концентрации были определены благодаря тесту (T @ sty test ™), недавно разработанному нашей группой (патент WO2015 / 165880). В этом тесте используются тестовые листы из съедобной вафельной бумаги.Тестовый лист состоит из шести серий по три предварительно нарезанных диска (диаметром 18 мм). Для каждой серии один диск содержит вкус («вкусный диск»), а два других нейтральны. На одном тестовом листе концентрация вкусовых веществ постепенно увеличивается от первой серии к шестой серии (рис. 1). Концентрации были выбраны для получения гауссовского распределения индивидуальных оценок среди населения в целом.


    Для каждой серии испытуемым предлагалось попробовать три диска, положив их на кончик языка на несколько секунд, и найти вкусный диск, ответив на следующий вопрос: Какой диск отличается от двух других? Испытуемым было предложено ответить случайным образом, если не было замечено никакой разницы.Ответы, записанные для полного тестового листа, были преобразованы в оценку от 0 (низкая чувствительность, максимальная концентрация не воспринимается) до 6 (высокая чувствительность, все концентрации воспринимаются). Подсчет баллов был основан на методе Best-Estimate Threshold (BET): каждый тестовый лист давал серию из 6 ответов (правильный / неправильный), упорядоченных по возрастанию концентрации вкусового вещества. Оценка соответствует количеству последовательных правильных ответов после наивысшей концентрации, на которую был дан неправильный ответ.Например, оценка 2 соответствует случаю, когда ответы, данные для шестой и пятой серий, являются правильными, а ответ для четвертой серии неверен, независимо от ответов, данных для другой серии. Для каждого вкуса оценка чувствительности представляла собой среднее значение, рассчитанное для четырех повторов.

    2.7. Статистический анализ

    Статистический анализ проводился с помощью программы Statistica (StatSoft). Парные t-тесты были выполнены для оценки разницы в pH и составе между слюной и пленкой языка.Корреляция Пирсона была рассчитана между pH в слюне и pH в пленке. Корреляцию между оценками вкусовой чувствительности и биологическими данными оценивали с помощью корреляционных тестов Спирмена. Выбор непараметрического теста в этом случае оправдан наличием цензурированных данных (баллы = 0 или 6) в сенсорном наборе данных. Оценка 0 указывает на то, что субъект будет воспринимать вкусовое вещество только выше самой высокой представленной концентрации, тогда как оценка 6 указывает, что субъект может воспринимать вкус даже ниже самой низкой представленной концентрации.

    3. Результаты
    3.1. pH слюны и пленки языка

    pH слюны варьировал от 5,89 до 7,00 (в среднем 6,47 ± 0,29) и был значительно ниже ( p <0,001), чем pH пленки языка, который варьировал от 6,53 до 7,86 (в среднем 7,15). ± 0,36). Более того, значимая корреляция (r = 0,839; p <0,001) наблюдалась между pH слюны и pH пленки.

    3.2. Скорость потока слюны и масса языковой пленки

    Результаты представлены в таблице 2.Скорость потока слюны сильно варьировалась: от 0,05 до 1,13 г / мин (в среднем 0,45 ± 0,31 г / мин). Влажная масса пленки языка варьировала от 7 до 51 мг (в среднем 25 ± 12 мг).


    Среднее значение Мин. Макс SD
    отклонение
    (SD)

    Расход слюны 0.45 0,05 1,13 0,36 0,31 68,6
    (г / мин)
    Вес язычка пленки 0,025 0,007 0,051 0,020 0,012 48,5
    (г)

    3.3. Профили сахаров и органических кислот

    Концентрации и процентное содержание четырех сахаров (глюкоза, фруктоза, сахароза и лактоза) и четырех органических кислот (молочная кислота, уксусная кислота, пропионовая кислота и масляная кислота) в слюне и пленке языка показаны на Таблица 3.Глюкоза (16,9 ± 10,5 μ г / г в слюне; 6,2 ± 7,0 μ г / г в пленке) и уксусная кислота (145,8 ± 121,5 μ г / г в слюне; 389,9 ± 242,3 μ г / г) преобладали сахар и кислота, соответственно.


    Соединение Концентрация в Концентрация в Пропорция в Пропорция в p
    слюна ( г / г SD) пленка ( г / г SD) слюна ( SD) пленка ( SD)

    глюкоза 16.9 ± 10,5 6,2 ± 7,0 95,4 ± 10,5 89,7 ± 7,0 <0,05
    фруктоза 0,3 ± 0,3 0,3 ± 0,2 1,6 ± 0,3 3,6 ± 0,2 < 0,05
    сахароза 0,1 ± 0,1 0,2 ± 0,3 0,4 ± 0,1 2,4 ± 0,3 <0,05
    .

    сообщений о биохимических и биофизических исследованиях - журнал

    BBRC - самый быстрый электронный журнал!

    Журнал № 1 в рейтинге Clarivate JCR для Biophysics по общему количеству цитирований и количеству статей.

    От отправки до онлайн менее чем за 3 недели!

    Biochemical and Biophysical Research Communications - главный международный журнал, посвященный ...

    Прочитайте больше

    BBRC - самый быстрый электронный журнал!

    Журнал № 1 в рейтинге Clarivate JCR для Biophysics по общему количеству цитирований и количеству статей.

    От отправки до онлайн менее чем за 3 недели!

    Biochemical and Biophysical Research Communications - ведущий международный журнал, посвященный очень быстрому распространению своевременных и значимых экспериментальных результатов в различных областях биологических исследований. Благодаря развитию раздела «Прорывы и взгляды» в журнал был добавлен формат мини-обзоров, и выпуски часто содержат коллекции рукописей, представляющих особый интерес. BBRC издается еженедельно (52 номера в год).

    Области исследований теперь включают:
    Биохимия
    Биоинформатика
    Биофизика
    Исследования рака
    Клеточная биология
    Биология развития
    Иммунология
    Нейробиология
    Биология растений
    Протеомика

    Преимущества для авторов
    Мы также предоставляем множество преимуществ для авторов, такие как бесплатные PDF-файлы, либеральная политика авторских прав, специальные скидки на публикации Elsevier и многое другое .Щелкните здесь, чтобы получить дополнительную информацию о наших услугах для авторов.

    Информацию о подаче статей см. В нашем Руководстве для авторов. Если вам потребуется дополнительная информация или помощь, посетите наш Центр поддержки

    Hide full Aims & Scope .

    Обеспечение качества микробиологии в лабораториях анализа кормов

    % PDF-1.6 % 1 0 obj > >> endobj 8 0 объект > endobj 2 0 obj > / Шрифт> >> / Поля [] >> endobj 3 0 obj > ручей 2013-05-20T15: 05: 26 + 02: 002013-06-10T16: 41: 05 + 02: 002013-06-10T16: 41: 05 + 02: 00Adobe InDesign CS6 (Windows) 1uuid: b11bf895-7ff7-45c6- b3ab-f41a6a5efde2adobe: docid: indd: d0eb8aac-4856-11d9-88a6-fc8a8a6f2008xmp.id: 0CBA91D24DC1E211B84BCEA1C7D43774proof: pdfxmp.iid: 0BBA211x84DC.сделал: ED8CAD467291E21197E7F0947713EC5Cadobe: docid: indd: d0eb8aac-4856-11d9-88a6-fc8a8a6f20081default

  • преобразовано из приложения / x-indesign в приложение / pdfAdobe InDesign CS6: 9-05-2013: 02/2003 (Windows): application / pdf
  • Обеспечение качества микробиологии в лабораториях по анализу кормов - Руководство ФАО по животноводству и здоровью, № 16
  • Р.А. Коуи
  • Adobe PDF Library 10.0.1 Ложь конечный поток endobj 4 0 obj > endobj 5 0 obj > endobj 6 0 obj > endobj 7 0 объект > endobj 9 0 объект > endobj 10 0 obj > endobj 11 0 объект > endobj 12 0 объект > / ExtGState> / Шрифт> / ProcSet [/ PDF / Text / ImageB / ImageC] / Свойства> / XObject> >> / Повернуть 0 / TrimBox [0.7x ߄5 v ~ zί ~ 5PrNk ٕ R \ BS0 'ؖ s * 0 ܶ MχdU QR 1% jVx-BN) ˛xP ["qjjEI: ZpT + Nn

    .

    Смотрите также